histidine
Q: Which monosaccharide is known as blood sugar in the body? glucose galactose fructose
A: Monosaccharide is a simple sugar consisting only of one unit ("mono" means one). They serve as…
Q: The steps involved in the T→ R transition in when oxygen binds to hemoglobin are outlined below.…
A: The correct order of the steps involved in the T → R transition in hemoglobin when oxygen binds is…
Q: During glycolysis, glucose is converted into fructose-6- phosphate in two successive reactions:…
A:
Q: Proteins are made from chains of amino acids. The amino acids are joined together by structures…
A: Dipeptide
Q: Briefly describe the major components of a successful biosensor.
A: A biosensor is an analytical device. It is used for the detection of chemical substances. The…
Q: Part B. Classify Fatty Acids as Saturated or Unsaturated 2. Identify each fatty acid below as…
A:
Q: One way of expressing the rate at which an enzyme can catalyze a reaction is to state its turnover…
A: Turnover number of an enzyme is defined as the number of substrate molecules converted into its…
Q: Using the values of pKas in the table below, calculate the pỈ for DTLH. Properties of some amino…
A:
Q: Match each characteristic to the appropriate process. Anabolic process breaks down macromolecules…
A: Metabolism is the sum total of all chemical reactions taking place in lifeforms. It can be divided…
Q: Match the colour of myoglobin to the ligand bound. brown red pink 1. carbon monoxide 2. nitric oxide…
A: Muscle tissue contains a protein called myoglobin, which is essential for storing and transferring…
Q: 1. Draw the structure of the following peptide: ala-asp-gly-lys-ser-glu-val-arg-his-gly. What would…
A: pKa is the pH at which a weak acid is 50% dissociated. When pH < pKa of the ionising group, the…
Q: Identify the species that are liganded to the porphyrin ring Fe(II) ion in deoxyhemoglobin (i.e., Hb…
A: The protein haemoglobin, which is present in red blood cells, is essential for the movement of…
Q: The following is [Select] [Select] CH OH OH OH OH V glycosidic bond. CH₂OH О OH ОН disaccharide with…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula:…
Q: There is another melanocyte-stimulating hormone called B-melanotropin. Cleavage of 3-melanotropin…
A: We have found out the sequence of amino acids in alpha melanotropin.
Q: Assume that the complete combustion of one mole of glucose to carbon dioxide and water liberates…
A: Given:Complete combustion of one mole of glucose liberates 2870 kJ.ΔG° = -2870 kJ/mol Efficiency of…
Q: +H₂N-CH-COO™ 1 CH₂ I CH₂ I CH₂ I +H₂N-CH₂ A. amino acid D O amino acid B amino acid C O amino acid A…
A: Amino acids are biomolecules that have a hydrogen atom, an amino group and a carboxyl group linked…
Q: I. Active site analysis. Below is a diagram of a putative active site for Monoamine oxidase. As we…
A: A protein's tertiary structures are the result of canonical forces that stabilize protein structure.…
Q: Complete the sentences describing membrane lipids by moving the names of the lipids to the…
A: There are four types of biological macromolecules: nucleic acids, proteins, lipids and…
Q: Which of the following statements is WRONG with regard to the following molecule?
A: A cell is the basic structural and functional unit of life where all the metabolic activities are…
Q: Protein X binds to molecule A. When [A] = 24.5 µmol L-1 at equilibrium, half of X is bound to A and…
A: Protein X binds to molecule A. When [A] = 24.5 µmol L-1 at equilibrium, half of X is bound to A and…
Q: Synthesis of the activated form of acetate (acetyl-CoA) is carried out in an ATP-dependent process.…
A: The nucleotide coenzyme adenosine triphosphate (ATP) is the most important form of chemical energy…
Q: Equation 7a of the text, (max/KM1) [S]-(v'max/KM2) [P] 1+ [S]/KM1 + [P]/KM2 gives the expression for…
A: The following are given in the equation:V represents the rate of the reaction.S represents the…
Q: II. While there are many different types of inhibitors, most have a very similar structure so they…
A: Enzymes are high molecular weight protein that catalyse biochemical reactions. They contain a active…
Q: For the following reaction mechanism, which of the following statements would be false? R" R :B NO R…
A: Enzymes are proteins that catalyze biochemical reactions. Some enzymes require non non-protein…
Q: You are studying a biochemical pathway that requires ATP as an energy source. To your dismay, the…
A: ATP is the energy currency that the cell spends on metabolic transactions. ATP is produced in two…
Q: Macmillan Consider the data collected for an enzyme-catalyzed reaction. % (mM-s-¹) 0.37 0.83 2.22…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: You analyze a protein of 100 kDa using SDS-PAGE in the absence and presence of �-mercaptoethanol…
A: Multisubunit proteins are composed of more than 1 polypeptide chain.SDS (sodium dodecyl sulfate)…
Q: An enzyme mechanism generates a positive charge in the transition state. Stabilization of the…
A: The intermediate state which is formed during a reaction is called transition state.This transition…
Q: trypsin Enter your answers separated by a comma(s). Name peptides using the one-letter…
A: There are four classes of biological macromolecules: proteins, nucleic acids, lipids and…
Q: Which of the following is TRUE? Chylomicrons have more triglycerides than HDLs. HDL carries both…
A: In the human body, lipoproteins are essential for lipid transport and metabolism. The equilibrium of…
Q: Which of the outcomes could potentially result if a mutation in the gene encoding the Ga subunit…
A: Heterotrimeric G protein is a complex comprised of 3 protein subunits;, and . They are often…
Q: Explain the role of transistors in microchip functionality
A: Microchips are tiny electronic devices containing a variety of integrated circuits. They are…
Q: 5. ANSWER THE FOLLOWING PROBLEM AND EXPLAIN YOUR ANSWER FOR BETTER UNDERSTANDING. Fill in the blanks…
A: Amino acids are biomolecules that have a hydrogen, a carboxyl group, an amino group and a chemically…
Q: What peptides are expected to be produced when an unknown hormone (…
A: The amino acid sequence of the hormone of concern in one-letter abbreviation is given…
Q: Model 1 Model 1 Idealized Graphs of Enzyme inhibition Competitive Inhibition FEE Inh. slope How does…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: Which of the following amino acids have R groups that have hydrogen-bonding potential? Explain.…
A: A hydrogen bond is a type of non-covalent bond formed between a hydrogen bond donor and a hydrogen…
Q: What is the difference between fast and slow glycoly
A: Fast and slow glycolysis are two distinct metabolic pathways that cells employ to generate ATP…
Q: More and more bacteria are becoming antibiotic-resistant. How might this affect our ability to fight…
A: When bacteria evolves mechanism to nullify the effect of antibiotics used on them.This generally…
Q: (a) The kinetic data given below are for the reaction catalyzed by prostaglandin endoperoxide…
A: According to Michaelis - Menton equation velocity of an enzyme increases with substrate…
Q: mtDNA depletion syndrome 13 is a rare genetic disorder, in which individuals have fewer mitochondria…
A: When oxygen saturation in myocytes is lower than normal, myocytes could have impaired oxidative…
Q: Glycogen can form alpha 1-->4 and beta 1--> 6 linkages alpha 1--> 4 and alpha 1--> 6 linkages alpha…
A: Classification of carbohydrates: Monosaccharide: it composed of single sugar molecule. Example:…
Q: Assume that the complete combustion of one mole of fructose, a monosaccharide, to carbon dioxide and…
A: ∆G°' = -2810 kJ/mol∆G°'compound x = -38.1 kJ/mol Moles =?
Q: How many co2 are produced from 1 glucose and 1 c16 fatty acid?
A: During the process of cellular respiration, one glucose molecule breaks down into six carbon dioxide…
Q: Which structure likely represents a GPCR? A B e C D
A: G protein-coupled receptors are abbreviated as GPCRs.These are integral membrane proteins…
Q: 2. Mitochondria isolated from bovine cardiac muscle, when subjected to sonication, form closed mem-…
A: The electrons released as NADH is oxidized, is carried to O2 via series of protein and non-protein…
Q: The graph shows the hormone-binding specificity of a hypothetical membrane receptor. The results are…
A: The equilibrium dissociation constant (Kd) is used as a measure of affinity between a hormone and…
Q: A major pathway for metabolism of ethanol is shown below. Humans consuming a large fraction of their…
A: Glycolysis is enzymatic conversion of glucose to pyruvate with concomitant reduction of NAD to NADH…
Q: What might happen to someone if their cells no longer recognized ghrelin's message? they would never…
A: Ghrelin is a hormone produced mainly by the stomach and, to a lesser extent, by other tissues in the…
Q: A polypeptide is cleaved into peptides by treatment with trypsin and cyanogen bromide, and then the…
A: Trypsin cleaves specifically peptide bonds at the C-terminal side of lysine (K) and arginine (R)…
Q: We humans do not express an alpha-Galactosidase enzyme and therefore cannot break down stachyose but…
A: Stachyose is a tetrasaccharide made up of two , one and one . Stachyose can be represented as .Gal…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- What is the isoelectric point of this fragment? DHVTHLRKMGPathogenic E. coil have recently been shown to degrade tight junction proteins during infection. How would this provide an advantage to the bacteria?Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stop
- Draw the structure of this peptide: N-Met-His-Tyr-Leu-Asp-Ser-Arg-Leu-CSecond letter A UUU UCU) UC UCA UCG UAU UUC Phe UUA Tyr UGU UGCJ Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUG Leu CAUHIS CUU CUC CUA CUG CCU* C ССА CCG CGU His САС Leu CGC Arg CGA Pro CAA Gin CGGJ Gln Which amino acid is carried by the TRNA with the anticodon 5'-UCA-3? ACU ACC ACA AAU AAC. AGU AGC AGA AUU Ser Asn AUC Ile A AUA Thr AAA Lys AAG Lys AGG Arg AUG Met ACG GAU GGU] GUU GUC GUA GUGJ GCU GCC GCA GCG GAC Asp Ala GAA GGC Gly GGA Val GAG Glu GGGJ Isoleucine. None-this is a stop codon. Aspartic acid. Histidine. IV. Leucine O V. Third letter UCAG UCAG UCAG First letterture.com/courses/7611/assignments/170598?module_itemid%3D695428 TR E Edulastic: Formativ. A Desmos | Testing O YouTube I Quiz | ReadTheory Quill.org - In О в, С, А, D D, B, A, C C, B, D, A How many nucleotides are represented in the diagram? * 2 points O 6 12 18
- (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 21Cut the following protein with the Serine Proteolytic enzyme Trypsin. How many peptide fragments are present after the protein is treated with Trypsin? Val-lle-Arg-Lys-Leu-Arg-Gly-Ala-Lys-lle 6. 10Historial Marcadores Ventana Ayuda 0 Question 41 What is specifically illustrated in the figure below? Self- complementary sequence RNA polymerase DNA 5' 3' P つつつ 3' 5' RNA transcription A (4444 O carrollcc.instructure.com Edit View Insert Format Tools Table OO Hairpin loop (GC-rich) บบบบบบ 3′ RNA O е 12pt ✓ Paragraph | BIUA 2 T²V | V (LD) 5' ♫ tv A A Ċ 1 pts C T A
- B. Enumerate all the possible DNA nucleotide base sequence for the amino acids given. 4. Met – Leu – Ala - Gly- Glu - Gly- Gln- Glu- Ala - Ala - Pro - LeuGiven the structures of the ribonucleotides and deoxyribonucleotides: Adenine Uracil Thymine HN Adenine NH HO-P-0- CH2 HO-P-0 CH2 HO-P-0-CH2 HO-P-0-CH он он он он OH H OH H Cytosine Cytosine Guanine Guanine NH2 NH NH2 CH2 HOo CH2 HO-P-0 -CH2 он он он он OH H OH H • Draw the structure of the polyribonucleotide UAGCCUG. Draw the structure of the polydeoxyribonucleotide CGTAGAT.Given the polypeptide chain below: Ala-Arg-Val-His-Asp-Gln 1. What is the N-terminus? 2.What is the C-terminus?