Write the corresponding section of a mRNA produced from each of the following DNA sections: a. DNA: 3'-A-T-G-A-C-G-C-T-A-5' b. DNA: 3'-G-T-A-C-C-A-T-A-C-G-A-G-G-C-5'
Q: Representations of sequencing chromatograms for variants of the a chain of human hemoglobin are…
A: The sequencig chromatograms given in question are generated as we conduct Automated DNA sequencing…
Q: "de 96 5 no
A: Answer :- The pH of the solution and the pKa values of the side chains of amino acids must be taken…
Q: On block 1 (Glycogen Metabolism) fill in the missing pathway (beginning at G6P and ending at…
A: Glycogen metabolism is the process by which glucose-6-phosphate is changed into the branched glucose…
Q: Which organelle of liver cells (hepatocytes) does the most biotransformation?
A: The term biotransformation refers to the modification of chemical substances inside a living thing,…
Q: Discuss the effect of EDTA on ca absorbance in AAS experiment
A: EDTA stands for Ethylenediaminetetraacetic acid, is a type of anticoagulant which prevents the blood…
Q: Draw the structure of malibiose a sugar found in plants and answer the following question: a) What…
A: Melibiose is a disaccharide composed of two monosaccharide units: glucose and galactose. The linkage…
Q: histidine
A: Histidine, an essential amino acid, fulfills diverse roles in biological systems, demonstrating…
Q: Which of the following amino acids have R groups that have hydrogen-bonding potential? Explain.…
A: A hydrogen bond is a type of non-covalent bond formed between a hydrogen bond donor and a hydrogen…
Q: ANSWER THE FOLLOWING PROBLEM AND EXPLAIN YOUR ANSWER FOR BETTER UNDERSTANDING. No. 3. Which Amino…
A: There are four classes of biological macromolecules; proteins, nucleic acid, lipids and…
Q: We did an experiment about carbohydrate chemistry and the prof did not elaborate on the details. She…
A: There are four types of biological macromolecules- nucleic acid, proteins, lipids and…
Q: You fill a (fixed volume) dialysis bag with a solution of a protein (1 mM) in water, seal the…
A: Dialysis tubing can be defined as a semi permeable membrane tubing is particularly used in…
Q: epinephrine and noradrenaline related?
A: Epinephrine and Noradrenaline:Epinephrine is also known as Adrenaline.Noradrenaline is also known…
Q: Draw the linear fisher projections of D-ribarnic acid, L-xyluronic acid, D-arabinuronic acid,…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: We did an experiment about carbohydrate chemistry and the prof did not elaborate on the details. She…
A: Moore's test is used to detect the presence of reducing carbohydrates. Here, the sample is treated…
Q: Glucagon is a hormone that is released when the level of glucose in the blood is low. Glucagon uses…
A: Glucagon is secreted by the α cells of pancreas.Glucagon is a hormone that helps to regulate blood…
Q: Which of the following statements regarding the ends of polysaccharides are true? 1) All…
A: Polysaccharides are polymers of monosaccharides. Multiple monosaccharides get bonded to each other…
Q: Question 1. What is the O₂ saturation in the lungs? 2. What is the O₂ saturation in tissues at rest?…
A: We can find the O2 saturation % of hemoglobin at various conditions in various organs of the body…
Q: The concentrations of ATP, ADP, and P; differ with cell type. Consequently, the release of free…
A: Since conditions inside the cell are different than standard temperature and pressure, biochemists…
Q: Fehling's Test: Some sources say that Fehling's test will be positive only for Aldoses not for…
A: There are four classes of biological macromolecules; namely nucleic acids, proteins, lipids and…
Q: What would be the difference in ATP generated from beta oxidation of a 14C fatty acid with 1 double…
A: The process of breaking down fatty acid molecules in prokaryotes cytosol and eukaryotes mitochondria…
Q: Cold-blooded animals modulate the fatty acid composition of their membranes as a function of…
A: Answer :- Animals classified as cold-blooded, or ectotherms, depend on the outside temperature to…
Q: 2. Mitochondria isolated from bovine cardiac muscle, when subjected to sonication, form closed mem-…
A: The electron transport chain contains four complexes: Complex I, II, III and IV. Electrons are…
Q: The hormone which regulates pH in the intestine is called: a) cholecystokinin b) secretin c)…
A: The objective of the first question is to identify the hormone that regulates pH in the intestine.…
Q: 3. Now for the citric acid cycle, it is time to follow the carbons! Using labeled pyruvate:…
A: Citric acid cycle is a metabolic pathway that regenerates oxaloacetate from citrate. Acetyl CoA from…
Q: Which of the following is the a-anomer? H но H Но H2C H ОН H2C- нн ОН со 4 1 2 1 Submit 3 -OH Н ОН…
A: Alpha anomer
Q: Construct a mechanism where sarin inhibits acetylcholinerase.
A: The objective of this question is to understand the mechanism by which the nerve gas sarin inhibits…
Q: Which of the following statements describes one reason that plant oils are generally healthier for…
A: Plant oils are liquid fats extracted from various plant sources, such as seeds, nuts, and fruits.…
Q: The effect of an inhibitor on an enzyme was tested and the experiment gave the results below. If…
A: Inhibition can be either reversible or irreversible. Reversible inhibition can be generally of 3…
Q: Briefly list out the chemicals contributing the anti-oxidative activities found in green tea.
A: Green tea is the most widely consumed beverage, following water.The chemicals present in green tea…
Q: rostaglandin synthase converts which molecule into prostaglandin H2? ____________ Movement of a…
A: The biological membrane that surrounds a living cell is called the cell membrane. The structure of…
Q: Step 2 Part A: Where did the extra oxygen come from for the 12 oxygen required to make 4 molecules…
A: Glycolysis is the ten-step conversion of 1 molecule of glucose to 2 molecules of pyruvate. ATP and…
Q: The steps to convert chaulmoogra oil into an injectable treatment are: 1. extraction II.…
A: The chaulmoorga oil was used to treat leprosy. In earlier times the extracted seed oil was directly…
Q: Label the N- & C termini Label ALL alpha - carbons (with an alpha) Label ALL peptide bonds(…
A: Pepetides are composed of amino acids joined together by peptide bonds. All linear peptides have an…
Q: 3. Show that the inverse of equation 29-78 in the textbook gives the Lineweaver-Burk Equation. The…
A: The Michaelis-Menten (MM) equation is the general equation used in most enzyme kinetic studies. The…
Q: [AktivGrid] Draw the ketone body formed in ketogenesis from the condensation of two acetyl CoA…
A: Acetyl-CoA is a molecule that plays an important role in many biochemical reactions in protein,…
Q: Consider the following fatty acid attached below. a) What is the number convention for this…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbons to 36 carbons.The…
Q: The graph shows the hormone-binding specificity of a hypothetical membrane receptor. The results are…
A: The equilibrium dissociation constant (Kd) is used as a measure of affinity between a hormone and…
Q: 1. The liver produces glucose to the rest of the body between meals by breaking down glycogen stores…
A: Glucose is the body’s principle source of energy that is derived as a macronutrient in certain…
Q: Why must NH3 be transported as part of an amino acids vs. being released into circulation? What…
A: Ammonia is produced in all tissues of the body during the metabolism of amino acids and other…
Q: escribe the developments in genomic sequencing over the past 50 years
A: Genomic sequencing is the process of determining the precise order of nucleotides (adenine, thymine,…
Q: 200 microliters of a standard solution of 0.200 mg/mL caffeine was mixed with 4.8 mL of 50 mM sodium…
A: Equation of dilution: M1 × V1 = M2 × V2where:M1 is the molar concentration of the stock solution.M2…
Q: 1. The following data were obtained for a competitive inhibition study in which the [I] = 3 µM for…
A: In competitive inhibition, only the apparent Km is affected (Km,app> Km),The Vmax remains…
Q: How is it possible to determine the structure of an enzyme substrate complex by x ray…
A: The objective of the question is to understand how the structure of an enzyme-substrate complex can…
Q: Calculate the membrane potential in the transport of Cl- from the intracellular environment to the…
A: Change in Gibbs free energy () for ion transport across a membrane is contributed by the…
Q: A paste of starch was tested using Benedict’s test, the Iodine Test, and Fehling’s Test. Before…
A: There are four types of biological macromolecules- nucleic acid, proteins, lipids and…
Q: 6. ANSWER THE FOLLOWING PROBLEM AND EXPLAIN YOUR ANSWER FOR BETTER UNDERSTANDING. Fill in the blanks…
A: There are four classes of biological macromolecules: They are proteins, nucleic acids, lipids and…
Q: Oxygen is mainly carried through blood in what form?
A: Oxygen is essential for ATP generation through oxidative phosphorylation, and therefore must be…
Q: Why are closure and completeness important in genome seq
A: Closure and completeness are two critical aspects in genome sequencing that play a fundamental role…
Q: Balance the reactions. A hint is provided to help you decide if the reaction will proceed as…
A: Since you asked multiple questions so as per Q&A guidelines of portal I answered first question…
Q: All of the following statements about the B-oxidation pathway are true except: The pathway is…
A: In metabolism, β-oxidation is the catabolic process by which fatty acid molecules are broken down.…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- How many kilobases of the DNA strand below will code for the protein product?Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helix
- The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Indicate the 3’ and 5’ ends of both strands. G C T A T A A T G G C A a a a t t g G G T C A G G C A a a t c g a C A T A G C T G A C G G g g a t g a G G T T A A C G A T A T T A C C G T t t t a a c C C A G T C C G T t t a g c t G T A T C G A C T G C C c c t a c t C C A A T T 2.Write the pre-mRNA molecule. Indicate the 3’ and 5’ ends. 3. Write the mRNA molecule. Indicate the 3’ and 5’ ends 4. Write the tRNA anticodons corresponding to the codons in the mRNA. 5. Write the sequence of amino acids in the resulting polypeptide.Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’
- For each of the following sequences, fill in either the DNA, the mRNA sequence, or the amino acid sequences that have been left blank. DNA______ ______ ______ ______ ______ ______ ______ ______ ______ mRNA A U G A C U A G C U G G G G G U A U U A C U U U U A G AA______ ______ ______ ______ ______ ______ ______ ______ ______Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: C G A T A C A A T G G A C C C G G T A T G C G A T A T C C mRNA: G C U A U G U U A C C U G G G C C A U A C G C U A U A G G Codon: Anitcodon: Amino Acids:
- Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the RNA synthesized above (item #1) is a functional mRNA and all the nucleotides belong to an exon,a. how many codons are present in this mRNA?b. how many codons actually code for proteins in this mRNA?c. what stop codon is present in this mRNA?Write the base sequence in a complementary DNA segment if each original segment has the following base sequence: a.) 5'T T T T T T 3' b.) 5'C C C C C C C C C 3' c.) 5'A T G G C A 3' d.) 5'A T A T G C G C T A A A 3'A small section of a gene for a protein has the following nucleotide sequence: GCT CTA GCT ATC TGA Which of the following mutations would cuase a silent mutation in the sequence shown above? a. Replacement of second adenine base with thymine base b. Replacement of first thymine base with adenine base c. Replacement of second guanine base with cytosine base d. Replacement of first cytosine base with guanine base