What is the role of his 12 in the RNase-catalyzed hydrolysis of RNA, as indicated inthe Figure below?5'His 119RNACH₂HH3OBase1'12'8-HHis 12-P-0-CH₂ a BaseH HO-0-P=OHOHNHIt acts as a general base, abstracting a proton from the 2' hydroxyl in order toincrease its nucleophilicity.It forms an H-bond with his119 in order to stabilize the transition state.It donates a proton to improve the quality of the leaving group.It works through concerted general acid-base catalysis with his119 in order tofavour the products of the reaction.Two of the above are true.

Enzyme deploy different chemical mechanisms to catalyse biochemical reactions. One such mechanism is…

Answered: What is the role of his 12 in the…

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter26: Synthesis And Degradation Of Nucleotides

Section: Chapter Questions

Problem 6P: Allosteric Regulation of Ribonucleotide Reductase by ATP and Deoxynucleotides Describe the...

See similar textbooks

Similar questions

What is the role of his119 in the RNase-catalyzed hydrolysis of RNA, as indicated in the Figure below? RNA -0-CH₂ Q Base His 119 H H NH His 12 -P-0-CH₂ a Base H H 3' H O 2' O-H OH O -0-P=0 It acts as a general base, abstracting a proton from the 2' hydroxyl in order to increase its nucleophilicity. It forms an H-bond with his12 in order to stabilize the transition state. It serves as a general acid, donating a proton to improve the quality of the leaving group. It works through concerted general acid-base catalysis with his 12 in order to favour the products of the reaction. Two of the above are true.
You are presented with Cytidine 5' triphosphate and Thymidine 5' triphosphate. Draw and upload to Efundi these phosphorylated structures as they would be connected in a polinucleotide in the order CpT / Show the individual phosphorylated structures first then show how they combine to form the polynuleotide. Show at any one of these structures where the glycosidic bond occurs
Suggest a reasonable strategy for the specific phosphorylation of the5’ –OH group of a nucleoside.
Treatment of a polypeptide by 2-mercaptoethanol yields two polypeptides that have the following amino acid sequences: Ala-Phe-Cys-Met-Tyr-Cys-Leu-Trp-Cys-Asn Val-Cys-Trp-Val-Ile-Phe-Gly-Cys-Lys Chymotrypsin-catalyzed hydrolysis of the intact polypeptide yields polypeptide fragments with the following amino acid compositions: (Ala, Phe) (Asn, Cys2, Met,Tyr) (Cys, Gly, Lys) (Cys2, Leu,Trp2,Val) (Ile, Phe,Val) Indicate the positions of the disulfide bonds in the original polypeptide. I don't understand how the order of amino acids in Step 2 was arranged. Please explain. Thank you.
Treatment of a polypeptide by 2-mercaptoethanol yields two polypeptides that have the following amino acid sequences: Ala-Phe-Cys-Met-Tyr-Cys-Leu-Trp-Cys-Asn Val-Cys-Trp-Val-Ile-Phe-Gly-Cys-Lys Chymotrypsin-catalyzed hydrolysis of the intact polypeptide yields polypeptide fragments with the following amino acid compositions: (Ala, Phe) (Asn, Cys2, Met,Tyr) (Cys, Gly, Lys) (Cys2, Leu,Trp2,Val) (Ile, Phe,Val) Indicate the positions of the disulfide bonds in the original polypeptide.
Allosteric Regulation of Ribonucleotide Reductase by ATP and Deoxynucleotides Describe the underlying rationale for the regulatory effects exerted on ribonucleotide reductase by ATP, dATP, dTTP, and dGTP.
In pyrimidine nucleosides the anti conformation predominates because of steric interactions with pentose. Do thepurine nucleosides have similar interactions?
Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stop
Why is ti advantageous for a cell to expend metabolic energy to polymerize gulucose molecule.?
Protease enzymes cleave proteins by hydrolyzing peptide bonds. The strategy for each type of metalloprotease begins with generating a nucleophile that attacks the peptide bond that attacks the peptide carbonyl group. O Macmillan Learning On the basis of the information provided in the figure, show the next step in the mechanism for peptide-bond cleavage by a metalloprotease. Metalloproteases H R₁ HN Zn Enz 2+ R₂ Draw curved arrows on the pre-drawn structures to show the metalloprotease mechanism. If you need to reset the structures, click More followed by Reset Drawing. Select Draw Templates Groups More B - H Enz H H с R1 | : HN O | Zn 2+ B R2 N Zn Erase
The following amino acids that are often found inside globulin molecules are () A, Tyr B, Phe C, Asn D, Glu True of false 1. In the de novo synthesis of purine nucleotides and pyrimidine nucleotides, base rings are first synthesized and then corresponding nucleotides are formed with phosphoribose. () 2. Transcription is the process of transferring genetic information from DNA to RNA. DNA is synthesized under the catalysis of RNA polymerase, and the direction of synthesis is from the 5 'end to the 3' end. () 3. The change of protein conformation is caused by the breaking of covalent bonds within the molecule. () 4. In very high and very low pH solutions, amino acids exist mainly in non-ionic form. () 5. The active center of an enzyme usually consists of several amino acid residues adjacent to each other in the primary structure. ()
E Threonine 6. You have identified some intermediates in threonine synthesis: A, B, C, D and E. You grow a few of your mutants in the presence of these different intermediates to determine the order in which the gene products act. Below are your results. A (+) means growth and a (-) means no growth. Given these data, draw the best possible pathway for the synthesis of threonine. The diagram should use arrows to indicate one intermediate being changed to another intermediate. Indicate which gene produces the product responsible for the conversion by listing the mutant in that gene above the arrow. Mt1 Mt2 Mt4 Mt7

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS