9. What are the primary differences between site-specific recombination and general recombination? Give an example of the biological context in which you might expect to find each of these. (One example for each is sufficient.)
Q: For the DNA sequence shown, indicate the products of its cleavage with the following restriction…
A: In the field of molecular biology and genetic engineering, restriction enzymes, commonly referred to…
Q: 2.(a) The two diagrams on the right compare O2 binding pro- perties of Hb Kariya, a human hemo-…
A: Here we are given the hill plot for analyzing the binding kinetics of 2 hemoglobin (Hb) variants,…
Q: the DNA segment 5′-ATGAGGCATGAGACG-3′(coding strand) 3′-TACTCCGTACTCTGC-5′ (template strand) •…
A: Replication is the process in which template strand of DNA is copied into complementary strand of…
Q: Consider the fatty acid. Which of the designations are accurate for the fatty acid? 6-3 fatty acid…
A: Fatty acids are carboxylic acids having long chains of hydrocarbons attached to them. It is…
Q: ration Determine how reaction rate (velocity) varies with substrate concentration. Rate increases…
A: Q.Explanation:- Substrate is a specific term for the reactant on which a particular type of enzyme…
Q: Briefly describe the difference between a reversible and irreversible reaction in a metabolic…
A: A metabolic pathway is a sequential series of linked biochemical reactions that convert a starting…
Q: Cyclic photophosphorylation uses two photons to generate one ATP. If the AG of ATP hydrolysis is -50…
A: Percent efficiency is defined as a measure of the manner in which how efficiently a process or…
Q: . Make a series (at least 3) of drawings to show the three dehydration synthesis reactions that take…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: In the diagram below, the orange circle represents an effector and the dark purple shapes (both the…
A: An allosteric effector, also referred to as an allosteric regulator, is defined as a molecule which…
Q: when calculating the Resting membrance potential using the goldman equation it is usally out, out…
A: The Goldman equation is often used to determine the resting membrane potential of a cell. It…
Q: Which of the following is/are true regarding SDS-PAGE (there may be more than one correct answer,…
A: SDS-PAGE is the abbreviation for Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis.It is a…
Q: Proto-oncogenes are genes that have the potential to become oncogenes through either mutation or an…
A: Genes are the segments of DNA that code for proteins. These are passed from parents to offspring. A…
Q: The illustration below shows several oxygen-dissociation curves. Assume that curve 3 corresponds to…
A: We know that hemoglobin (Hb) is the protein responsible for carrying O2 in blood. Certain other…
Q: 2. You are in a South American rain forest looking for naturally occuring peptides with potential as…
A: Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: You discover a protein that displays improved catalytic efficiency. Would you predict that this…
A: Catalytic efficiency, can be defined as a measure of how efficiently an enzyme converts substrates…
Q: 1a. If you wanted you could take a glucose molecule and convert it to pyruvate via glycolysis and…
A: Hello! Due to time constraints, we are able to provide the answer for the first sub part only. If…
Q: Part C Calculate to three decimal places the charge on a-melanotropin at pH value of 5. Express your…
A: Net charge on the amino acid with negative side group: Net charge on the amino acid with positive…
Q: be the A form of DNA, the B form of DNA, the Z form of DNA, or all three. A form the favored form of…
A: DNA called deoxyribonucleic acid is made up of nucleotides. Each nucleotide is nade up of a -…
Q: how do telomeres protect against replicative shortening
A: Telomeres occur as repetitive regions found towards the end of a chromosome. Telomeres occur in a…
Q: In a reaction system, the concentrations of Enzyme-Substrate complex [ES], free enzyme [E] and free…
A: An indicator of the degree to which two molecules are bound together, the equilibrium association…
Q: Which amino acid residue is most likely to be found in position "a" or "d" of the pseudo repeat in?…
A: Proteins are the important biomolecules synthesized in biological cells as final products of gene…
Q: Most of the GLP-1 receptor structure form part of the transmembrane domain (TMD) that is embedded in…
A: Glucagon-like peptide-1 (GLP-1) is a 30- or 31-amino-acid-long peptide hormone derived from…
Q: During glycolysis, glucose is converted into fructose-6- phosphate in two successive reactions:…
A:
Q: How many ATP, NADH, and FADH are formed in the krebs cycle?
A: Cellular respiration can be defined simply as a series of metabolic processes that take place within…
Q: 1. The figure below shows the ribosome elongation cycle in translation. Label the features indicated…
A: Translation is the process by which a polypeptide chain is synthesized based on the information…
Q: Do the P-waves of different subjects have the same amplitude? The QRS complexes? The T-waves? Why?
A: The P-wave, QRS complex, and T-wave amplitudes can vary between individuals due to differences in…
Q: Consider an enzyme-catalyzed reaction that follows Michaelis-Menten kinetics with KM =3.0 mmol·dm-3…
A: When a substrate (S) binds to the active site of an enzyme (E), it leads to the formation of an ES…
Q: An enzyme with an unknown reaction mechanism has been isolated and is being investigated in the lab.…
A: General acid/base: proton transfer occurs between enzyme and substrate. Note that water is not a…
Q: 1. The citric acid cycle ends with the reaction catalyzed by malate dehydrogenase (MDH) shown below.…
A: Standard change in Gibbs free energy () is the change in Gibbs free energy () value observed under…
Q: 14-16. List the group (nonpolar, polar, acidic, or basic) for each of the following armino acids:…
A: Amino acids are broadly grouped into polar and nonpolar. Nonpolar amino acids can be further divided…
Q: trypsin Enter your answers separated by a comma(s). Name peptides using the one-letter…
A: There are four classes of biological macromolecules: proteins, nucleic acids, lipids and…
Q: 1. Provide a reasonable step-wise mechanism for the reaction below, involving FAD as a coenzyme and…
A: Each cycle of fatty acid oxidation in cellular mitochondria begins with the catalysis of an enzyme…
Q: Which one of these molecules would not be in a membrane? HC-0 НО HC-0 HC-0 image A D Galactose is a…
A: The most prevalent lipid molecules found in plasma membranes, commonly referred to as cell…
Q: The following diagram shows reaction curves for aspartate transcarbamoylase (ATCase) with…
A: Allosteric enzyme is the class of regulatory enzyme which increases or decreases catalytic activity…
Q: In the peptide Ala – Gly – Val – Phe – Tyr, a carboxylate (-COO-) group would bound in which amino…
A: The four types of biological macromolecules are proteins, nucleic acids, lipids and…
Q: Draw the structure of the peptide DTLH, showing the backbone and side-chain atoms, at its…
A: There are four classes of biological macromolecules - proteins, nucleic acids, carbohydrates and…
Q: Write out the mechanism for transimination, the reaction of an amino acid with enzyme-bound PLP to…
A: The transimination reaction, also known as the Schiff base formation,involving the transfer of a…
Q: Which type of motifs/folds are found in the protein shown below O Colled-coil O EF Hand O Horseshoe…
A: The final products of the expression, "the proteins" attain higher folding confirmation of…
Q: The second messenger cyclic AMP (CAMP) is synthesized from ATP by the activity of the enzyme…
A: Some signalling molecules cannot diffuse across the biological membranes so they communicate their…
Q: Which of the following statements are true about the relationships of [S], KM, and Vmax? (Choose…
A: For a one-substrate enzyme catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: Lodgum are true TS
A: The biological process of moving molecules or ions across a cell membrane against their…
Q: The turnover number is defined as the maximum number of substrate molecules that can be converted…
A: We need all the quantities in each parameter to be in the same unit, if we are to use them in an…
Q: You are characterizing a new DNA polymerase. In a test tube, you incubate the enzyme with all the…
A: DNA is a molecule made up of two strands twisted around each other in a double helix shape. Each…
Q: Explain the role of transistors in microchip functionality
A: Microchips are tiny electronic devices containing a variety of integrated circuits. They are…
Q: Two possible point mutations are the substitution of lysine for leucine or the substitution of…
A: Amino acid mutations refer to changes in the DNA sequence that result in alterations to the sequence…
Q: The dominant motif found in hemoglobin and myoglobin is: a) twisted beta sheet b) beta barrel c)…
A: 1)The dominant motif found in hemoglobin and myoglobin is (b) beta barrel.2)myoglobin consists of (d…
Q: Identify the species that are liganded to the porphyrin ring Fe(II) ion in deoxyhemoglobin (i.e., Hb…
A: The protein haemoglobin, which is present in red blood cells, is essential for the movement of…
Q: There is another melanocyte-stimulating hormone called B-melanotropin. Cleavage of 3-melanotropin…
A: We have found out the sequence of amino acids in alpha melanotropin.
Q: Complete the Haworth projection of B-D-fructose. The anomeric carbon is shown. C H Answer Bank OH…
A:
Q: Draw the Fischer projections of the four aldotetroses. Draw the D-sugar on the left and its L-isomer…
A: There are four classes of biological macromolecules; proteins, nucleic acids, carbohydrates and…
Step by step
Solved in 3 steps
- 18. Shown below are the results of a series of coinfections of E. coli B using T4 rlI- strains similar to those employed by Benzer in his deletion mapping experiment. Each strain contains a different deletion mutation. The ability to produce wild-type progeny phage is indicated by (+), (0) indicates no wild-type progeny. A D A B D E Which order of deletions is most consistent with this data? a. CDBEA b. DCEAB C. ABECD d. CDEAB e. EDCBA. The double-stranded circular DNA molecule thatforms the genome of the SV40 tumor virus can be denatured into single-stranded DNA molecules. Becausethe base composition of the two strands differs, thestrands can be separated on the basis of their densityinto two strands designated W(atson) and C(rick). When each of the purified preparations of the single strands was mixed with mRNA from cells infectedwith the virus, hybrids were formed between the RNAand DNA. Closer analysis of these hybridizationsshowed that RNAs that hybridized with the W preparation were different from RNAs that hybridized withthe C preparation. What does this tell you about thetranscription templates for the different classes ofRNAs?28. In a transformation experiment, DNA is collected from an E. coli donor strain of genotype cys(+) leu(-) thr(+) and used to transform a recipient of genotype cys(-) leu(+) thr(-). Initially, the treated recipient population is plated on a minimal medium supplemented with threonine. Many colonies are obtained. What are possible genotypes of these colonies? A. cys(-) leu(+) thr(+) B. cys(+) leu(+) thr(-) C. All are cys(+) and either + or - for leu and thr D. All are thr(+) and either + or - for cys and leu E. All are thr(-) cys(-) and either + or - - for CYS
- 1. An individual is heterozygous (CT) for a common C/T SNP that is tested using the Axiom microarray (used by the UK Biobank). Two left apex probes at different spots on the microarray will interrogate this SNP, testing both strands of the SNP. Draw the genomic DNA hybridized to both probes and show the dideoxynucleotides added, the fluorescence observed, and the signal recorded at each spot.A molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro. Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’ Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’7. (a) Describe the mechanism by which human cells maintain a chromosome structure that consists of overall negatively supercoiled DNA. Make sure to name the specific chromosome structures that are important for this effect. (b) How is overall maintenance of negative supercoiling accomplished differently in E. coli?!
- 8. As explained in the text, the cause of many geneticdiseases cannot yet be discerned by analyzing wholeexome/genome sequences. But in some of theseseemingly intractable cases, important clues can beobtained by looking at mRNAs or proteins, ratherthan at the DNA.a. As you will see in more detail in later chapters, it ispossible to use single-molecule methods to sequence cDNA copies of millions of mRNA molecules from any particular tissue cheaply. Howcould you sometimes use such information to finda disease gene? When would this information benoninformative?b. A technique called Western blotting allows you toexamine any protein for which you have an antibody; it is possible to see differences in size oramount of that protein. How could you sometimesuse such information to find a disease gene? Whenwould this information be noninformative?"10. Recall the Meselson and Weigle experiment that used two strains of bacteriophage with unique genetic marks ("A and B" or "a and b"). The location of these marks at the end of the chromosome and in close proximity to each other was important for them to get a robust experimental result (configuration 1 below). Imagine that these genetic marks were located in the two additional configurations listed below. Draw the distribution of recombinants (Ab and aB) in a CsCl gradient for all three configurations." A w.Heavy 1 a V Light An w Heavy b maã Light a A B N Heavy a W Light 2.The completely synthetic yeast chromosome Syn IIIcontains a loxP site in the 3′ UTR of every gene thatis potentially nonessential to yeast survival. As youwill recall from Chapter 6, loxP sites are targets ofsite-specific recombination. The researchers who constructed Syn III included these loxP sites as a way to“scramble” the chromosome, meaning that parts ofthe chromosome could easily be deleted or rearranged.The goal of these investigations is to drive the evolution of Syn III so as to define a minimal genome thatcan support the life of this organism. Outline the experiment the researchers would do to scramble Syn IIIin order to define a minimal genome.
- 1. Certain proteins that stimulate expression of a gene bind to DNA in a sequence specific manner and also induce conformational changes in the DNA. Describe the purpose of thses two modes of interaction with the DNA. 2. Draw the structures of the amino acid side chains that correspond to the following histone modification: a) acetylation of lysine; b) phosphorylation of serine; c) phosphorylation of histidine. How do thses modifications change the character of their respective side chain?8.Iron-uptake protein IupA is a human 302-aa, N-glycosylated, heterodimeric protein of considerable therapeutic interest. It contains 3 disulfide bridges that stabilise its structure. Explain what expression host you would use to produce the protein in recombinant form.. E. coli chromosomes in which every nitrogen atom is labeled (that is, every nitrogen atom is the heavy isotope15N instead of the normal isotope 14N) are allowed to replicate in an environment in which all the nitrogen is 14N.Using a solid line to represent a heavy polynucleotidechain and a dashed line for a light chain, sketch each ofthe following descriptions:a. The heavy parental chromosome and the productsof the first replication after transfer to a 14N medium,assuming that the chromosome is one DNA doublehelix and that replication is semiconservative.b. Repeat part a, but now assume that replication isconservative.c. If the daughter chromosomes from the first divisionin 14N are spun in a cesium chloride density gradientand a single band is obtained, which of the possibilitiesin parts a and b can be ruled out? Reconsider theMeselson and Stahl experiment: What does it prove?