Step 2: Acyl-AMP + → acyl-CoA + COA COA + ADP PP i 2 ADP CoA The acyl-CoA synthet ly reversible, with AMP m constant near 1. to favor formation of f ATP ATP The enzyme-bound intermediate in this reaction has been identified as the mixed anhydride of the fatty acid and adenosine 2ºmonophosphate (AMP), acyl-AMP. R-C-O-P-O-CH2 0- Adenine 0. H H H H OH OH Complete the two equations corresponding to the two steps of the reaction catalyzed by acyl-CoA synthetase. Step 1: R-COO¯+ → acyl-AMP + COA ATP Step 2: Acyl-AMP + AMP → acyl- ADP + P H₂O H+ ATP COA The acyl-CoA synthe PP n is readily reversib i PP; ibrium constant near 1. How can this reaction be made 1
Q: 2. (a) ( In contrast to the pyruvate dehydrogen- ase complex, the a-ketoglutarate dehydrogenase…
A: Approach to solving the question:Presence of Pi and Ca²⁺:When Pi (inorganic phosphate) is present in…
Q: You have a protein with MW 48kDa. How many grams of protein are in a 200 mL sample at 50 μM?
A: To calculate the amount of protein in grams in a 200 mL sample with a concentration of 50 μM, follow…
Q: Which statement about BPG's interaction with hemoglobin is correct? Group of answer choices BPG…
A: Here are the reasons why the other option is wrong: BPG binds to a specific part of the hemoglobin…
Q: None
A: Answer - basic. This amino acid is histidine. It is basic because the side-chain imidazole ring can…
Q: You will have to dilute your inital Lysozyme stock in order to pipet volumes larger than 10 uL for…
A: Step 1:For the Bradford assay, the typical concentration range of protein you want to target is…
Q: 1.(a) ( ) Trace the course of [1,6-(C-14)-2,5-(C-13)]glucose that is first processed through…
A: Explanation of [1,6-(C-14)-2,5-(C-13)] glucose BreakdownThis explanation accompanies the answer,…
Q: Consider the following Peptide: Alanine-Lysine-Glutamine-Serine-Glycine Select all that applies Give…
A: Peptides are short chain of amino acids linked by peptide bonds. Amino acids that have been…
Q: 9. Which reactions in Model 2 are hydrolysis reactions? 10. Write the soap formed in the following…
A: hydrolysis is an chemical reaction , in which a molecule of water is breaks into One or more…
Q: A partial diploid in E. coli is created so that LacI is no longer expressed from the genome and is…
A: Partial diploid E.coli has both chromosomal DNA (i.e. genome) and plasmid DNA, but all the genes are…
Q: Transcription factors bind to: Question 20 options: DNA regions called…
A: Transcription factors bind to: DNA regions called cis-acting elementsExplanation:The question…
Q: Only 500% sure experts solve it correct
A: Peptides and Amino AcidsAmino acid monomers are joined into small chains called peptides by peptide…
Q: Assume the helium-neon lasers commonly used in student physics laboratories have power outputs of…
A: Please see the attached images for the solution. If there are queries or if the images are not…
Q: An enzyme is mutated such that the KM of the mutated enzyme is lower than the KM of the original…
A: The objective of the question is to understand the effects of a mutation that lowers the KM of an…
Q: What is(are) the only active site(s) not used in the second round of fatty acid synthase? Select all…
A: Here's a breakdown of why these are not used in the second round: Acetyl-CoA ACP Transacylase: This…
Q: To determine whether this organism is capable of performing carbohydrate metabolism, ateam of…
A: The objective of the question is to develop a protocol for the purification of the enzyme…
Q: A fluorescence recovery after photobleaching (FRAP) was performed at 37 °C. If the experiment were…
A: The objective of the question is to understand the effect of temperature on the rate of fluorescence…
Q: In three sentences describe how Sanger sequencing works
A: Copying DNA: To determine the sequence of DNA, scientists start by making many copies of the DNA…
Q: 5. Trehalose, a disaccharide produced in fungi, has the following structure: CH₂OH H OH H H H H OH H…
A: a. α-D-glucopyranosyl-(1→1)-α-D-glucopyranoside b. Trehalose is not a reducing sugar.Explanation:…
Q: The cofactor shown below: is an oxidizing agent is a reducing agent is a carrier of acyl groups is…
A: The given structure is of the FAD molecule. FAD = Flavin adenine dinucleotide.
Q: Digestion of cellobiose in cows produces two glucose units which is then absorbed into the bloodand…
A: Approach to solving the question: yield of ATP during cellular respirationOne glucose molecule used…
Q: A common technique used to identify the genetic variants within a population that cause adverse drug…
A: SNP arrays (Single Nucleotide Polymorphism Arrays) are commonly used to detect single nucleotide…
Q: A 70-year-old woman visited her GP complaining of a sore throat, a fever (38.5°C), and recent loss…
A: the patients symptoms and elevated liver enzymes ,alongside positive IgM antibodies for Epstein-Barr…
Q: Which of the following disaccharide repeats is the most stable towards hydrolysis? A.…
A: Stability of disaccharide repeats (or any polysaccharide) towards hydrolysis depends primarily on…
Q: Help pls :(
A:
Q: what reagents should be used to genbwrate the final product. provide the complete mechanism -+ OH
A:
Q: Complete the following reaction by filling in the necessary reagents. NH₂ S. 1) Br 2) Draw the…
A: Step 1:• In this reaction firstly, amine group undergoes diazotization and further undergoes attack…
Q: None
A: The statement in question relates to the process of decarboxylation in the tricarboxylic acid (TCA)…
Q: The model I was given is picene and I need to answer this question:
A:
Q: Below are the reduction reactions for oxygen and FAD. ½202 + 2e + 2H+ → H20 E°' = 0.83 V FAD + 2e +…
A: Step 1:Step 2: Step 3: Step 4:
Q: Relative Microbial Activity 1.00 0.80 0.60 0.40 0.20 0.00 20 ⚫02 consumption • CO2 production 40 60…
A: Let's delve deeper into the process of denitrification, which is a microbial process occurring in…
Q: If instead of using the pyruvate for gluconeogenesis, the pyruvate entered the mitochondria, what…
A: The question states that if pyruvate enters the mitochondria instead of being used for…
Q: Please help me fill in all the information
A: 1. **Conversion of Pyruvate to Acetyl-CoA**: - **Pyruvate Dehydrogenase Complex**: This complex of…
Q: The RNA sequence below encodes a very short protein: 5’ ACCGUACGACCAUGUCCCACUAUCCCUAGGCGAUC 3’…
A: Start and Stop Codons:In the genetic code, certain codons have specific roles. The codon "AUG"…
Q: Under low tryptophanyl-tRNA (tRNAtrp), we expect the trp operon to be expressed because: Question…
A: Trp operon functioning in the bacterial system Escherichia coli consists of a set of genes that…
Q: phosphofructokinase reaction of Fructose-2,6-bisphosphate is a regulator of both glycolysis and…
A: Activates glycolysis and inhibits gluconeogenesis:Increased levels of…
Q: Calculate the equilibrium membrane potentials to be expected across a membrane at 37 ∘C, with a NaCl…
A: The objective of this question is to calculate the equilibrium membrane potential across a membrane…
Q: Answer the following questions concerning sulfathiazole below by filling ieach blank with the…
A: Step 1: In sulfathiazole, the nitrogen atom is indeed sp² hybridized. This means that one of the…
Q: molecule 0= FO FO OH OH OH type of molecule (check all that apply) ☐ fatty acid ח ח ח ח…
A: The block diagram shows several rectangular blocks labeled with logic gates (OR, AND, NOT) and their…
Q: Your colleague handed you a novel strain of coli that is purifying a protein with a 6xHisTag; they…
A: Detailed ExplainationCompetitive Metal Chelation:Dicarboxylic acids, such as citric acid, have…
Q: For every molecule of glucose produced, gluconeogenesis consumes: O2 ATP and 2 NADH ☐ 4 ATP and 1…
A: For every molecule of glucose produced during gluconeogenesis, the process consumes 6 molecules of…
Q: Why is 1, 2, 3, 4-tetraphenylcylopentadienone a dark purple color while most other organic compounds…
A: Option a: This option is incorrect because, 1, 2, 3, 4 - tetraphenylcylopentadienone is not a…
Q: When grown anaerobically on glucose, yeast (S. cerevisiae) converts pyruvate to acetaldehyde, then…
A: Step 1: When grown anaerobically on glucose, yeast (S. cerevisiae) converts pyruvate to…
Q: Genes that encode proteins that promote apoptosis in response to cellular stress are referred to as:…
A: The genes you're looking for are called:Tumor suppressors Here's why:Tumor suppressors: These genes…
Q: Calculate KI (in units of nmol L-1) for a competitive inhibitor that has α = 1.65 when 11.0 nmol L-1…
A: α=1+ [I]/KIWhere:α (alpha) is the degree of inhibition[I] is the concentration of the inhibitorKI…
Q: All are principal allosteric regulatory "signals" controlling the TCA cycle activity EXCEPT:…
A: (a). Acetyl-CoA: High levels of acetyl-CoA indicate that the TCA cycle has sufficient fuel, thus…
Q: I need help filling in the boxes
A:
Q: The electronic excitation method in fluorescence and absorption spectroscopy is the same. What are…
A: In fluorescence and absorption spectroscopy, both methods involve electronic excitation of…
Q: The following data is for the oxidation of catechol (the substrate) to o-quinone by the enzyme…
A: Phenoloxidase is a key enzyme in melanization that catalyzes the oxidation of phenols.…
Q: Calcium is an important regulator of the citric acid cycle. Calcium is transported across the…
A: Step 1:Step 2:Step 3:Step 4:
Q: a) How does the Grotthuss mechanism and proton translocation through the membranes differ from the…
A: The chemiosmotic theory (some would argue that it is still a hypothesis and not a theory) has been…
Step by step
Solved in 2 steps with 1 images
- Extending the Mechanism of Methylmalonyl-CoA Mutase to Similar Reactions Based on the mechanism for the methylmalonyl-CoA mutase (see problem 14), write reasonable mechanisms for the following reactions shown.Fatty acids are converted to their coenzyme A esters in a reversible reaction catalyzed by acyl-CoA synthetase: R-COO +ATP +COA R-C-COA +AMP + PPi a) The reaction involves two steps the first of which forms an enzyme-bound intermediate identified as the mixed anhydride of the fatty acid and AMP: R-C-O-P-O-nibose-adenine Write two chemical equations coresponding to the two steps of the reaction catalyzed by the synthetase. b) The acyl-CoA synthetase reaction as written above is readily reversible. How might the reaction be made to favor formation of fatty acyl-CoA? Write within the box. Anything outside the box will not be graded. From theIncubation of the norsolinic acid synthase holo-ACP with malonyl CoA gave malonyl-S-ACP (molecular weight 10112 Da). (ACP SH holo-ACP Malonyl-SNAC Calculate the molecular weight of holo-ACP. (ACP OH malonyl-S-ACP MW = 10112
- In humans, the biosynthesis of L-glutamine is catalyzed by the L-glutamine synthetase. The global reaction can be written as follows: ATP + glutamate + NH3 ADP + phosphate + glutamine The A,Gº' value for this reaction is -16.3 kJ.mol-1 (from left to right). 1- Explain the significance this information. 2- This reaction can be considered as the sum of two component reactions which are exergonic and endergonic, respectively, under standard conditions. Write these two component reactions and evaluate A,Gº of the endergonic reaction. Data: A,Gº of ATP hydrolysis = -30.4 kJ mol-¹In the first step of the aldolase reaction, an active site Lys229 residue, with its side chain amino group in the deprotonated state, acts as a nucleophile and attacks the carbonyl C2 carbon of fructose 1,6-bisphosphate to form a Schiff base (boxed in the scheme). Since the pKa of the Lys side chain amino group in free solution is ~10.5, the pKa of Lys229 side chain must have been perturbed to a (higher lower) value for the enzyme to be active at neutral pH. the answer should include sufficient details, including the definition of pKa.The enzyme Glucose-6-phosphate dehydrogenase catalyzes the nicotinamide adenine dinucleotide oxidation of cyclic glucose-6-phosphate to form the lactone product shown below. Propose a mechanism for this reaction showing all electron flow (using the arrow convention). You must draw the substrate glucose-6-phosphate (the configuration of the anomeric carbon does not matter) and the “business end” of the cofactor.
- Draw the structures of the following coenzyme molecules: 1. CoA-SH/Acetyl-S-CoA 2. NAD*/NADH + H* • For both: Give full name (if you copy the formula from an Internet source, please cite it properly, for example, according to the Chicago Manual of Style. • Indicate what are the chemical groups that are active in these molecules, i.e., what group participates in metabolic reactions (be aware that both molecules may be involved in both anabolic and catabolic processes). • What vitamin or vitamins will, when modified, contribute to the structure of these molecules? • Write a short, general conclusion of the importance of these two coenzymes in metabolism.Draw the products of the reaction of xylulose-5-phosphate and erythrose-4-phosphate catalyzed by transketolase in the pentose phosphate pathway. Provide the structure in the protonation state found in physiological conditions. H H H OH FO HO-H H-OH H OPO3²- Q transketolase Draw glyceraldehyde-3- phosphate H H- H H H O OH OH OPO3²- Draw fructose-6- phosphate Q I IBehenate (C22H44O2) can be obtained by chain elongation from palmitate. How many ATP equivalents are produced in the degradation of behenate to eleven acetyl-CoA?
- One of the regulators of the TCA cycle is succinyl CoA. Discuss the rationale for this molecule to be used to regulate the TCA cycle [include chemical structures and chemical equations where appropriate]. What is an allosteric inhibitor? How does it operate? For what TCA enzymes does succinyl CoA act as an inhibitor? What is the metabolic role of succinyl CoA? So then why is this molecule a reasonable choice as an inhibitor of the TCA?In the hydrolysis of ATP to ADP and Pi, the equilibrium concentration of ATP is too small to be measured accurately. A better way of determining K’eq, and hence ΔG◦’ of this reaction, is to break it up into two steps whose values of ΔG◦’ can be accurately determined. This has been done using the following pair of reactions (the first being catalyzed by glutamine synthetase): (1) ATP + glutamate + NH3 ⇌ ADP + Pi + glutamine + H+ ΔG1◦’= -16.3 kJ/mol (2) glutamate + NH3 ⇌ glutamine + H2O + H+ ΔG2◦’= 14.2 kJ/mol What is the ΔG◦’ of ATP hydrolysis according to these data and is the overall reaction spontaneous? What is the value of the equilibrium constant for the overall reaction at 25.0 °C. If the concentration of ATP at equilibrium is 20.0 mM and the concentration of ADP at equilibrium is 50 nM. What is the concentration the phosphate group (in mM) at equilibrium?Some bacteria use the citric acid cycle intermediate, a-ketoglutarate, plus acetyl-CoA, as the starting point for lysine biosynthesis. The first part of this biosynthetic pathway uses the same chemical strategy found in the citric acid cycle. Propose a four-step pathway for the conversion of a-ketoglutarate to 2-oxoadipate. Draw the three missing intermediates, and indicate the chemistry involved in each reaction. Include any cofactors that you think might be required for specific steps.