Consider the image of protein synthesis (translation). Identify the two different RNA molecules involved in the process, as well as the amino acids being produced.
Q: Symport and antiport proteins must be active transport proteins A)True B)False
A: The biological membranes are selectively permeable. Transport across the biological membrane can be…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: The glycerol is a 3-carbon structure. (C―C―C) To each carbon atom there is attached one -OH group…
Q: Studies of the inner mitochondrial membrane reveal its composition to be approximately 20% lipid…
A: ATP is the energy currency that the cell spends on metabolic transactions. Mitochondria is the site…
Q: true or false: Guanylate phosphorylase is responsible for converting guanosine monophosphate into…
A: Nucleosides are pentose sugar linked to heterocyclic nitrogenous bases. Nucleotides are phosphoric…
Q: For the net production of a molecule of glucose from CO₂, ribulose-1,5-bisphosphate must react with…
A: Synthesis of glucose from phosphoglycerate occurs through the process gluconeogenesis. ribulose 1,5…
Q: A gene for albumin has 5 exons. When the DNA from this gene is allowed to hybridize with nuclear…
A: Introduction DNA is a self replicating molecule. mRNA is formed from DNA by a process called…
Q: Beta oxidation generates substrates for cellular respiration through which of the following…
A: The body requires an ongoing flow of energy to carry out its functions. Several substrate molecules…
Q: Choose the best answer for each blank. The pyruvate dehydrogenase (PDH) complex is regulated by the…
A: Glucose is oxidized during glycolysis and the end product (pyruvate) is converted to Acetyl CoA via…
Q: Maargerines made from plant oils are healthier, since they are hydrogenated for spreadability?…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: H3N. Amino acids are bonded together in a linear polymer to form peptides or proteins. A small…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: Based solely on the amount of NADPH produced, what is the total number of photons of light that must…
A: In the photosystems, NADPH is produced by a series of reactions starting from absorption of photons.…
Q: Please answer both Note :- Other wise down vote.
A: The reactions that involve biomolecules are called biochemical reactions. These occur inside the…
Q: Which enzyme catalyzes the following reaction?
A: MM kinetics relates the initial rate of a reaction with initial substrate concentration when the…
Q: What are the symptoms of nicotinamide deficiency and why are they so similar to the symptoms of an…
A: Nicotinamide is one of the forms of a vitamin, Niacin (Vitamin B3) in which the carboxyl group of…
Q: 1 lactose is the digestive enzyme that breaks the dissaxhrode lactose into glucose and…
A: Enzymes are usually composed of proteins which catalyzes biochemical reactions by decreasing the…
Q: 5. Thin layer chromatography separates lipids in the following order: hydroxylated lipids, then…
A: The working principle of thin-layer chromatography is the same as column chromatography. A small…
Q: What is the name of this cofactor related to niacin? 0
A: Enzymes are proteins that catalyse biochemical reaction. Sometimes enzymes require a non protein…
Q: In TCA cycle, FADH2 is formed in reaction(s) catalyzed by a. Succinyl-CoA synthetase b. Succinate…
A: In aerobic condition, pyruvate in the presence of pyruvate dehydrogenase complex produces Acetyl…
Q: The citric acid cycle is shown. The methyl carbon in acetyl CoA is labeled with C14C14 (shown in…
A: Citric acid cycle - it is also called as Krebs cycle or the TCA cycle (tricarboxylic acid cycle)…
Q: What is the purpose of the non-cyclic photophosphorylation? To generate NADPH for the…
A: The photophosphorylation that occurs in the grana of thylakoids in a non cyclic manner in which both…
Q: Glucagon causes [Select] Glucagon cause [Select] [Select] ✓ [Select] Glucagon causes [Select]…
A: Hormone glucagon is secreted by the pancreas in response to low glucose level. Glucagon primarily…
Q: What is the molecular mechanism of substrate channeling in the PDH complex? A. The swinging…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…
Q: All lipids are absorbed into absorptive cells of the small intestine by which process? Primary…
A: The biological membrane that surrounds a living cell is called the cell membrane. The structure of…
Q: How does ATP regulate the activity of PFK-1? ☐☐ ATP binds to PFK-1 at the catalytic site as a…
A: Glycolysis is a process in which glucose is oxidized & is converted to pyruvate and in that…
Q: In hepatocytes, the enzyme glucokinase catalyzes the ATP-coupled phosphorylation of glucose.…
A: In the reaction mechanism catalysed by glucokinase, glucokinase binds and brings ATP and glucose…
Q: Which of the following enzymes is inhibited as a result of insulin binding to its receptor? glycogen…
A: Insulin regulates the level of blood glucose by stimulating the uptake of glucose from the blood…
Q: The term that refers to the light-dependent process in plants in which O₂ is consumed and CO₂ is…
A: Plants need energy to perform the functions that keep them alive, just like all other living…
Q: Why stachyose can be used as prebiotic？？how is the chemical structure of stachyose affect bacteria？
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Draw structure of Cytosine, Thymine and Uracil and describe the difference in the structure?
A: Nucleotides vs nucleosides Nucleosides are pentose sugar(ribose in the case of RNA and deoxyribose…
Q: Describe the biochemical mechanism by which RNA splicing occurs precisely at the exon-intron borders…
A: One notable difference between prokaryotic genes and eukaryotic genes is that prokaryotic genes do…
Q: 4. The activation energy, E of a reaction may be lowered by c. 'adding a catalyst a. increasing the…
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: Could you help with part d? Create a speciation diagram for histidine by plotting Xi vs pH from pH =…
A: His is a basic amino acids with pKa value of its side chain ~6, amine and carboxyl groups pKa values…
Q: Catabolism - draw the complete citric acid cylcle for myristate
A: Myristate is a saturated fatty acid with 14 carbon atoms. Fatty acids are metabolized through the…
Q: Find 3 reactions that facilitate the synthesis of oxaloacetate
A: The tricarboxylic acid cycle (TCA) is the metabolic pathway that generates NADH and FADH2 for…
Q: Over the course of glycolysis and the citric acid cycle, there are 10 NADH and 2 FADH₂ produced per…
A: Number of ATP formed from each molecule of NADH and FADH2 through oxidative phosphorylation helps in…
Q: A mixture of lipids containing phosphatidic acid, cholesterol, testosterone, phosphatidylserine, and…
A: Non-polar molecules do not form a hydrogen bond with water can are thus considered hydrophobic.…
Q: A researcher found that a single point mutation in the genome of the SARS-CoV-2 virus resulted in a…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: If the range of the graph in the first part of the question is supposed to be between 5 and 10,…
A: Changes in pH affect the ionisation of active site residues of an enzyme and alters the rate of…
Q: Why is it critical that NAD* and FAD be regenerated inside the mitochondrial matrix rather than the…
A: NAD+ and FAD are coenzymes derived from vitamin B3 and vitamin B2 respectively. Both NAD+ and FAD…
Q: Draw the structure of the a-methyl-pyranoside form of mannose following the reaction of the sugar…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: hat roles do ionizable amino acids play in the active sites of enzymes
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Answer each question in the figure regarding reactants and products in the isocitrate dehydrogenase…
A: In the citric acid cycle, isocitrate dehydrogenase catalyzes the oxidation of isocitrate and…
Q: Virtually all animal cells have a Na+/K+ pump. Which of the following statements concerning it is…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Which of these chemicals damages the brain in a way that resembles Parkinson’s disease? A. Capsaicin…
A: Dopamine is a neurotransmitter. It is synthesised by dopaminergic neurons. Parkinson's disease is…
Q: Which of the following stabilize the hemoglobin quaternary structure of low-affinity to oxygen…
A: Haemoglobin is an important protein present in RBCs. It coprises of four subunits. Each subunit has…
Q: Why might a person who is gravely ill not want to participate in a placebo-controlled drug study?
A: Placebo-controlled drug study is a study done where one group of participants are given the actual…
Q: Given the following information about amino acid tyrosine answer questions 1 & 2: A. HO pka3 10.1…
A: Since you have posted multiple questions with multiple sub parts, we will provide the solution only…
Q: Finally, using the formula to convert between standard states, show that that your calculated values…
A: Chemical standard state is defined by standard conditions in chemical systems. These standard…
Q: 1. Classification, structure and properties of higher fatty acids, their biological role.
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: Be able to describe how the “law of mass action” drives bicarbonate formation when the blood is in…
A: In a reversible reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration…
Trending now
This is a popular solution!
Step by step
Solved in 4 steps with 1 images
- A Classwork for BTMF_Itani_ Biolo x A S'ERRA STANLEY -protein-synth X O 8 period light reaction - Google S x google.com/document/d/1plhyciPrM-AMsQKmaUHZSZU44EJL85jDuCyDxE01E60/edit - protein-synthesis-worksheet_practice-converted O sert Format Tools Add-ons Help TUR Last edit was 10 minutes ago 0% Normal text Noto Sans BIUA 川。 三E▼=、三三 13 + 田回▼ 1 3 4. 5 8. DNA → TAC AGA CGG CAA CTC TGG GTG CTT TGT TCT CTT CTC AGT ATC mRNA → protein > Son out Co 4. 6. 8. 9.Name: Date: 2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this s sequence into MRNA. er bns eldst eboo oi ebitqeqylog erlt to noihiog eri qu elsm bluow tsri abios onime Jlaw as ye s 1ot noitem atelomet AHG 3. The following MRNA ştrand is being used to asemble a polypE Classwork for BTMF_Itani_ Biolo X E SI'ERRA STANLEY - protein-synth X arch 8 period light reaction - Google S x ocs.google.com/document/d/1plhyciPrM-AMsQKmaUHZSZU44EJL85jDuCyDxE01E60/edit LEY-protein-synthesis-worksheet_practice-converted ☺ Insert Format Tools Add-ons Help Last edit was 5 minutes ago 100% Normal text Noto Sans . BIUA 12 川, 三= + - I 1. 2 . 4. 5 PART C. Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop. Follow example below: Example: DNA O AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC mRNA O UCU GCC AUG GAG GCC ACC CÁC GAA CAG ACA UAG GAA GAG UCA UAG protein 0 start - glu – ala -thre - hist – asp -glu-threo-stop acid acid 1. DNA → CCT CTT TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC MRNA → protein → 2. DNA → AGA ACA TAA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA MRNA → protein → 围 Sign out Co & 6. 7
- ty of Indianapolis : 20202 X ace.uindy.edu/portal/site/202020-BIOL-104-07/tool/2e4f1021-614d-4fae-83d6-ff99ca3767e0/jsf/delivery/beginTakingAssessment M Gmail YouTube Maps A ApneTV Home of H... What is the first step in protein synthesis? O A. making an RNA copy of the DNA within the nucleus B. making a sequence of amino acids O C. forming peptide bonds between amino acids OD. making a copy of RNA with DNA outside the nucleus Reset Selectionlight reaction - Google: Jod. google.com/document/d/1plhyciPrM-AMsQKmaUHZSZU44EJL85jDuCyDxE01E60/edit NLEY-protein-synthesis-worksheet_practice-converted @ w Insert Format Tools Add-ons Help Last edit was 7 minutes ago 100% - Normal text Noto Sans . BIUA 12 川, 三三▼ 3 5 Y 6. 7 I 3. DNA → TAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC MRNA → protein → 4. DNA → TAA ACT CGG TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA → protein → 5. DNA - CTA TTA CGA TAC TAG AGC GAA TAG AAA CTT ATC ATC MRNA → protein → Sign out 围 Ce & 6. 8. 3. de 58:52 Protein 1-10092015113603.pdf https:api.schoology.comv1attachment169963839... Name Class Date Section Protein Synthesis pages 148-153) 7-3 SECTION REVIEW In this section you studied the process of pro- tein synthesis. You learned that the informa- tion that DNA transfers to messenger RNA (MRNA) is in the form of a code. When the information is decoded, chains of amino acids, called polypeptides, are formed. Polypeptides During translation, each MRNA codon in turn make up proteins, which direct biochemical pathways and are responsible for cell structure and movement. The genetic code is determined by the arrangement of the nitrogenous bases in DNA and RNA. A code word in DNA consists of a group of three nucleotides. When transcribed into MRNA, each code word, or codon, desig- nates a specific amino acid that is to be placed in the polypeptide chain. More than one codon may code for a particular amíno acid. The MANA sequence AUG serves as an initiator, or "start," codon. Three other…
- Direction: Study the given amino acid sequence and DNA sequence of the Amino Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-LEU-LEU-SER What's More Activity 3.1 Check and Relate listed organisms. Cat DNA Sequence: TTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT Am no Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-EU-SER-ARG-LEU-LEU.AD DNA Sequence: CTTATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT Shark Amino Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-VAL-VAL-SER DNA Sequence: CTAATCCCCCCGTTTATCCTACTTTCCCATGTAGTAAGT Colphin Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-LE-LEU-LEU-SER-ARG-LEU-LEU-ARG DNA Sequence: CTAATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT Lizard Amino Add Sequence: ISO-4SO ASP-GLN-PHE-ILE-LEU-HIS-SER-ARG-LEU-LEU-ARG DNA Sequence: ATTATCGACCAGTTTATCCTACATTCCCGTCTACTTCGT Sponge Activity Questions: 1. Which organisms are closely related to each other? How are they related? 2. What does this tell us about the organisms and their ancestors? 3. How amino acid sequences and DNA…ebitgeqyloq erl to noihoq ertt qu 9lem bluow iert ebios onime et enimalsb nworle llew as yes TOi noitemoini ebulonl elelgmst AMO 3. The following MRNA strand is being used to assemble a polypeptide strand by a ribosome: 5'-AUGCUUGCUCAUCGGGGUUUUAA-3' AHR (a) Write out the amino acids that will be assembled, in their correct order. (b) Provide an alternative MRNA sequence with four or more changes that would translate to the same amino acid sequence.Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly (i.e., which molecule is actually translated?). E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites (in both prokaryotes and eukaryotes) and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly…
- Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly. E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly specify polarity. (You should use the labels 3', 5', C-terminus, and N-terminus.)Content C b. Biol 1406-Lec 17 Gene Exp X acconline.austincc.edu/ultra/courses/_891351_1/cl/outline Blackboard Learn q Which of the following statements about gene regulation is not true? O RNA interference is the inhibition of mRNA translation by siRNA's or miRNA's literally blocking access to the mRNA transcript or causing it to degrade. O X GWhich of the following staten X QUESTION 8 Paraphrasing Tool - QuillBot Al x Your disk is almost full Save space by optimizing st Alternative RNA splicing in eukaryotes can produce many different polypeptides from a single mRNA sequence by interpreting differing mRNA segments as introns or exons and splicing them accordingly. O DNA methylation can reduce or halt DNA transcription as DNA is negatively charged and the added methyl is negatively charged causing the methylated DNA to supercoil becoming inaccessible to RNA polymerase. O Some operons such as the lac operon can be controlled through both positive and negative gene regulation. O…A.C. 3.4 Q1. Protein synthesis is carried out by the processes of transcription and translation. A short length of DNA is shown: TACTCGTCGACGATGATC First base (a) State how many codons are present. (b) Using the table below, find the sequence of amino acids resulting from the transcription and translation of the length of DNA. Show your working. U U UUU Phenyl- UCU UUC alanine F UCC UCA -Leucine Lucc UUG-Le G CUU CUC CUA CUG A AUA -Leucine L AUU I AUC Isoleucine Methionine start codon AUG MMet GUUT GUC GUA GUG -Valine V CCU CCC CCA CCG ACU ACC ACA ACG C GCUT GCC GCA GCG Second base -Serine S -Proline P -Threonine -Alanine UAUT UAC A UAA UAG CAU CAC CAA CAG A Tyrosine Y Stop codon Stop codon -Histidine H -Glutamine AAA TAAG-Lysine AAC-Asparagine N GAU Aspartic GAC acid D GAG Glutamic G UGU-Cysteine C E UGC UGA UGG AGU AGC KAGG-Arginine CGUT CGC CGA CGG GGUT GGC GGA GGGJ Stop codon A Tryptophan -Arginine R Serine S R Glycine UCAG G SCAG SCAQ SCAG Third base