1 lactose is the digestive enzyme that breaks the dissaxhrode lactose into glucose and galactose.what class of enzyme do you think this belongs to? 2 NAD+ and FAD are essential cofactor for biological redox reactions when they gain electrons are they oxidized or reduced? 3 there are several modes for enzyme regulation. What is the difference between competitive and non competitive inhibition?
Q: can you explain this again in a different way
A: ATP is produced by either substrate-level phosphorylation or oxidative phosphorylation Hydrolysis of…
Q: A gerbil is fed a normal diet including 14C-lysine. After a period of time on this diet biopsies are…
A: Gerbils are mammals , so only mammalian metabolism can be used here. In the figure below showing the…
Q: Which of these are artificial sweeteners (Arts) and which are metabolized (Mtbs) by glycolysis?…
A: Artificial sweeteners are synthetic substitutes for sugars. These are sweet in taste and have less…
Q: What are the qualitative tests to characterize isolated RNA?
A: RNA or ribonucleic acid, most often single stranded nucleic acid found is all living organisms is…
Q: Why does glutamate the only amino acid used in oxidative deamination
A: Glutamate is an acidic amino acid that acts as the only amino acid used in oxidative deamination.…
Q: 1) Find the pH of 0.1 M of the differnet forms histidine species. (See image for equation and pKa…
A: Amino acids are building blocks of the proteins. Alpha carbon of amino acids consist of carboxyl…
Q: What are the Essential and Non-Essential Amino Acids? Describe each.
A: An amino acid is an organic compound that contains both an amino (-NH2) and carboxylic acid (-COOH)…
Q: Fill up the table below to summarize the confirmatory test for casein and whey. Test Sample…
A: Casein and whey are the 2 important classes of proteins in milk. The human milk composition is…
Q: 19) Why do enzymes have compact structures? (If enzymes weren't globular, then where would the…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: 4. Shown below is the structure of the anti-retroviral drug AZT. 5' HOCH, H 3 N₂ HN AZT H 12 H CH₂…
A: AZT is a drug that is used to treat HIV. HIV is a retro virus that causes the syndrome AIDS. When…
Q: Glycogen synthase in the liver is a target for phosphorylation by two protein kinases. What are…
A: Glycogen is a storage-type homopolysaccharide that contains two types of glucose polymers: amylose:…
Q: Explain biochemical pathways mechanistically. Describe the β-oxidation pathway. Describe the…
A: Lipids are stored in the form of triacylglycerols in the body. When there are no carbohydrates in…
Q: QUESTION 10 You are creating a set of Daphnia mutation accumulation (MA) lines to determine…
A: The accumulation of data on the genomic bases of adaptation has reignited interest in adaptation…
Q: Complex proteins-enzymes, their components. Prosthetic groups of complex protein-enzymes…
A: Complex proteins-enzymes have wide applications in metabolic activities and have many physiological…
Q: Which of the following is 18:248,11?
A: Fatty acids can be named and numbered in 2 ways. Fatty acids have a carboxylate end (COO- ) and a…
Q: Coupling ATP hydrolysis to glucose phosphorylation makes thermodynamic sense, but consider how the…
A: INTRODUCTION : Glucose phosphorylation in Glycolysis - In the cellular mechanism of Glycolysis, the…
Q: Which of the following are correct Dynein head elongates like a lever arm. ATP…
A: Movement of the body part is done by contraction and relaxation of contractile proteins.…
Q: 4. The figure below shows ATP in the binding site of pyruvate kinase, an important enzyme in…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: 2. Complete the following for serine, tyrosine, and gylcine. a. Draw the amino acid. b. Circle the…
A: Amino acids are the building blocks of proteins. they can be classified into different groups based…
Q: Choose the best answers for each missing word from the list below. (1)__________ is a first…
A: Biochemical cell signalling is the method by which cell communicates with each other cells and…
Q: What structural and functional advantages do proteins gain by associating to form quaternary…
A: In cellular environments, protein interaction networks contain crucial functional modules made up of…
Q: Which of the following is a structure of a sugar alcohol? Н I I H O CAB O CAR O CAP COOH OH нон CAT…
A: Sugar alcohols are formed when the aldehyde or keto group of the monosaccharide is treated with a…
Q: A researcher found that a single point mutation in the genome of the SARS-CoV-2 virus resulted in a…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: In the Krebs cycle, the energy released by taking a compound off Coenzyme A is used to: Group of…
A: There are 2 two reactions in Krebs cycle were a compound is taken off Coenzyme A (CoA-SH). These two…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: What is the role of HCO3 in the activity of pancreatic enzymes? 2. What factors are needed in the…
A: DISCLAIMER FOR MULTIPART Since you have posted a question with multiple sub-parts, we will solve…
Q: 7) In DNA/RNA chains, what is the direction of synthesis?
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: Explain the growing public health threats of emerging zoonotic infections and challenges in…
A: Zoonoses are diseases and infections that are naturally transmitted between humans and vertebrate…
Q: 2. Scheme of anaerobic oxidation of glucose and energy balance.
A: Organisms that live under anaerobic conditions rely only on glycolysis to generate ATP. Glycolysis…
Q: Select ALL statements that are true about the isoelectric point (pI) of a protein a.Protein carries…
A: The isoelectric point (pI) of a protein is the pH at which the protein is neutral or the overall…
Q: Use the gel image below to determine the sequence of the original DNA template strand sequenced…
A: As per the Watson-Crick model of the DNA double helix: DNA is made up of two strands of…
Q: Please explain the formula (process) used to get the Red undelived numbers, Thanks!! example each…
A: Enzyme kinetics - Enzymes are usually comprise of protein molecules which is used to catalyzed…
Q: The hormone interacts with the metabotropic receptor, as a result of further implementation of the…
A: The G protein is a protein found associated with G protein-coupled receptors. The receptor coupled…
Q: A scientist is studying the enzyme X which is an important point of regulation in the metabolism of…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: 1. Acetyl-CoA labeled with ¹4C in both of its acetate carbon atoms is incubated with unlabeled…
A: The citric acid cycle, also called as the Tricarboxylic acid (TCA) cycle is the central metabolic…
Q: could the answer be no cooperativity as well?
A: Cooperative binding is a phenomenon where the binding of one molecule increases the affinity of the…
Q: Suppose a student rinses their buret with water instead of sodium hydroxide, leaving water in the…
A: Introduction The titration is a chemical process by which the quantity of one substance of a sample…
Q: There is also another follow up question can you help me with this too please In the second cross, a…
A: A rabbit's coat colour is determined by four alleles: agouti (C), chinchilla (Cch), Himalayan (ch),…
Q: I have built an urn model for a DNA sequence. I have taken the letters from a sequence 1946…
A: DNA is composed of sequence of nucleotides (adenine, thymine, guanine and cytosine) linked by 3-5…
Q: At pH 7, the most predominant interaction between glucuronic acid (structure seen below) and the…
A: Electrostatic interactions are the interactions that might be attractive or repulsive that form…
Q: Which reaction or reactions of glycolysis require ATP as a reactant? List the enzymes that catalyze…
A: Glycolysis is a catabolic pathway in which glucose is broken down into two molecules of pyruvate to…
Q: How does ATP regulate the activity of PFK-1? ATP binds to PFK-1 at the catalytic site as a…
A: The enzyme phosphofructokinase 1 (PFK-1) catalyzes the following reaction: Fructose 6-P + ATP –>…
Q: Finally, using the formula to convert between standard states, show that that your calculated values…
A: Chemical standard state is defined by standard conditions in chemical systems. These standard…
Q: Which of the following is an anomer of B-D-gulopyranose? O ОН I ОН т ОН I I ОН CH2OH II- Б ОН CH2OH…
A: Anomers are cyclic monosaccharides differing from each other in the configuration at carbon no -1…
Q: a) What amino acid is metabolite 1? b) What kind of reaction occurs when 1 is converted to 2? c)…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group attached to…
Q: in a specrophotometry ethanol determination experiment, you measured OD340 and assumed this…
A: Nicotinamide adenine dinucleotide: The molecules nicotinamide adenine dinucleotide (NAD) and…
Q: Which electrolyte is most effected by hemolysis?
A: Hemolysis is the process of breakage of red blood cells. Hemolysis can be occurred due to viral and…
Q: Using Haworth projections, draw the structure of an a-disaccharide of mannose B(1,2) galactose…
A: Carbohydrates or carbs are macronutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: What are the symptoms of nicotinamide deficiency and why are they so similar to the symptoms of an…
A: Nicotinamide is one of the forms of a vitamin, Niacin (Vitamin B3) in which the carboxyl group of…
Q: Answer the Questions below: 1. Based on the experiment above, what is the means of detecting the…
A: Lipids are hydrophobic compounds that are usually made up of an alcohol backbone and a long chain…
Step by step
Solved in 2 steps with 1 images
- The following diagram shows reaction curves for aspartate transcarbamoylase (ATCase) with carbamoylphosphate and different concentrations of aspartate, in the absence of ATP (curve 1) and presence of ATP (curve 2). What do the shapes of the curves tell us about the ATCase enzyme? 2 جر [aspartate] It binds substrate through a sequential mechanism. It binds substte cooperatively. It obeys Michaelis-Menten kinetics. It binds substrate through a concerted mechanism.Enzyme 3 (diagram) is involved in negative feedback inhibition. It binds ATP at an inhibitory allosteric enzyme site on phosphofructokinase. What reagents does phosphofructokinase take into its active site. What are the products of the reaction that phosphofructokinase mediates. What do you think the ΔG (free energy) of this reaction is positive or negative, endothermic vs exothermic? Explain your answer above ATP is the end-product of ETC (electron transport chain), and at high concentrations of ATP, phosphofructokinase is inhibited allosterically. Please note that ATP is required in the active site. How does this mechanism act as a regulator for the entire ATP production pathway in mitochondria?1. What are the effects of pH and temperature to catalase? What is the optimum pH and optimum temperature for catalase? 2. Explain why the rate of reaction initially increases with increase in temperature then gradually declines as the temperature is further increased. 3. Is the rate of enzymatic reaction always directly dependent on enzyme concentration? Explain. 4. Explain the effect of substrate concentration on enzyme activity. 5. What is the effect of CuSO, on the enzymatic activity of catalase? 6. Is CuSO4 an activator or inhibitor? If it is an inhibitor, what kind of inhibitor is it?
- 8). Which statement best describes 1 point the enzyme represented in the graphs? O 10 20 30 40 50 60 O 2 4 6 10 12 Temperature ("C) PH (1) This enzyme works best at a temperature of 50°C and a pH of 12. (2) Temperature and pH have no effect on the action of this enzyme. (3) This enzyme works best at a temperature above 50°C and a pH above 12. (4) This enzyme works best at a temperature of 35°C and a pH of 8. Relative Rate of Enzyme Action Relative Rate of Enzyme Action1.The class of enzyme that catalyzes addition of a group to a double bond is? oxidoreductases lyases ligases isomerases hydrolases transferases 2. Suppose an enzyme and its substrate obey the lock and key model of enzyme catalysis. Which of the following would be true of the enzyme? the active site of the enzyme must be rigid the active site of the enzyme must be flexible only one substrate could be converted to product by the enzyme the enzyme could bind different substrates if the substrates shared a common motif somewhere in their structures the entire enzyme must be rigid 3. Which of the following enzymes is found in blood serum and is diagnostic of prostate cancer if enzyme levels are elevated? alanine aminotransferase phosphohexose isomerase lactate dehydrogenase acid phosphatase alkaline phosphatase 4. A blood test returns elevated aspartate aminotransferase levels. You suspect that the patient has suffered a heart attack. What other serum enzyme level of…1. What do some enzymes require for catalytic activity? What is a catalytically active complete enzyme called, along with its cofactor?2. Classify the enzymes. What class of enzymes are lactate dehydrogenase and alpha-amylase?3. What is the function of an enzyme as a catalyst? Where does an enzyme-catalyzed reaction occur?4. What is the most used enzyme activity unit? What is understood when one unit of enzyme activity is mentioned?5. What are the factors affecting the rate of an enzymatic reaction?6. What are the reasons why the rate of a reaction catalyzed by an enzyme decreases over time?7.Describe the relationship between ACE2 (Angiotensin converting enzyme 2) and the COVID-19 outbreak using bioinformatics tools.
- As biological catalysts, enzymes play a fundamental role in many cellular processes. Which of the following statements about enzymes is correct? 1. Enzymes are essential for anabolic pathways; they are not required for catabolic pathways. 2. While an increase in temperature can increase the rate of an uncatalyzed reaction, it can’t increase the rate of an enzyme-catalyzed reaction. 3. Enzymes force substrates into unique conformations that do not occur in the absence of an enzyme. 4. Enzymes decrease the free energy of a reaction’s transition state. A. 1, 2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1, 2, 3 and 4 are correctDraw each of the enzymatic step for each chemical conversion and write the enzyme together with the co-factor for the steps where a co-factor is involved. How many carbons are transferred in the conversion from step 1 into the intermediate from step 2? Step 1 OH ACP-s ? (multiple enzymatic steps) OH OH Step 2 ACP-S R1 5..1. Substrates and reactive groups in an enzyme’s active site must be precisely aligned in order for a productive reaction to occur. Why, then, is some conformational flexibility also a requirement for catalysis? 2. Some plants contain compounds that inhibit serine proteases. It has been hypothesized that these compounds protect the plant from proteolytic enzymes of insects and microorganisms that would damage the plant. Tofu, or bean curd, possesses these compounds. Manufacturers of tofu treat it to eliminate serine protease inhibitors. Why is this treatment necessary?
- 1.provide a solution using a table, listing all the specific individual reactions that will generate ATP either by substrate level phosphorylation (SLP) or by oxidative phosphorylation (OP). 2. Shall the given question require a shuttle system, please use both and indicate the net ATP for each. 3. Get the net ATP for each question given you Specific reaction Number of ATP (+ or -) Question 1: fructose 6-phosphate to 2acetyl coa Question 2: fructose 6-phosphate to 6C02 Question 3: fructose 6-phosphate to 2succinyl coaWhich of the following statements are true about enzyme regulation via noncovalent interactions? Select all that apply. Molecules can cause a change in enzyme shape because they're able to bind to the enzyme somewhere other than the active site The function of an enzyme is altered by a chemical change in its primary structure, which is called phosphorylation Molecules that are similar to the substrate in both size and shape can compete with the substrate for access to the enzyme's active site Molecules that are similar to the substrate in both size and shape can compete with the substrate for access to a location other than the active siteWhich class of enzymes have sigmoid or S-shaped plots of the rate of a reaction, v, versus the substrate concentration, [S], instead of the hyperbolic curves of the Michaelis-Menten equation? transferases holoenzymes O hydrolases O allosteric enzymes O ribozymes