Why is it critical that NAD* and FAD be regenerated inside the mitochondrial matrix rather than the cytosol? Because they maintain flux through the citrate cycle. Because anabolic reactions generally require them. Because they transport pyruvate through the matrix. Because they produce GDP through the citrate cycle.
Q: Compare and contrast glycogen synthesis/degradation in muscles as compared with the liver.
A: Glycogen is a storage polysaccharide made up of glucose units linked by alpha 1,4 and alpha 1,6…
Q: Why might a person who is gravely ill not want to participate in a placebo-controlled drug study?
A: Placebo-controlled drug study is a study done where one group of participants are given the actual…
Q: Which reaction or reactions of glycolysis require ATP as a reactant? List the enzymes that catalyze…
A: Glycolysis is a catabolic pathway in which glucose is broken down into two molecules of pyruvate to…
Q: What is the role of HCO3 in the activity of pancreatic enzymes? 2. What factors are needed in the…
A: DISCLAIMER FOR MULTIPART Since you have posted a question with multiple sub-parts, we will solve…
Q: Two villages in the Amazon depend on corn as a major staple in their diet. People in village A have…
A: Pellagra is a deficiency disease which is characterised by diarrhoea, mental disturbance, scaly…
Q: Which of the following is TRUE under the following conditions: the enzyme concentration is 2.5 nM,…
A: The rate of reaction can be determined by using Michaelis Menten equation. Michaelis Menten equation…
Q: Muscle glycogen phosphorylase, an enzyme that provides glucose to the muscle for energy production,…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Structure and biological role of phosphatidic acid.
A: The smallest and most basic phospholipid, phosphatidic acid (PA), serves as a precursor for other,…
Q: If the range of the graph in the first part of the question is supposed to be between 5 and 10,…
A: Changes in pH affect the ionisation of active site residues of an enzyme and alters the rate of…
Q: 2. The lipids: a. They are found in high concentrations in cells in free form. b. They have one or…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…
Q: 5. Which of the following is true about myoglobin and/or hemoglobin? O (a) The iron in Hb is in the…
A: Both hemoglobin & myoglobin are globular proteins. Our red blood cells (RBCs) are composed of…
Q: Effect of intramolecular and intermolecular forces of attraction to protein folding?
A: INTRODUCTION : Protein folding - It is a natural process through which a polypeptide chain is being…
Q: If the following monosaccharide underwent cyclization to form a furanose, which of the following is…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: 1) Perform the necessary calculations and fill in the values in the table below (be sure to include…
A: Enzymes are usually comprise of protein molecules which is used to catalyzed several biochemical…
Q: Draw the structure of the a-methyl-pyranoside form of mannose following the reaction of the sugar…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: Compare the molecular property of amino acids and their roles in protein folding.
A: There are 20 general proteogenic amino acids (amino acids that are often found in proteins). These…
Q: Which of the following will contain plain Galactose? Heparin Keratan Dermatan…
A: Carbohydrates can be classified into different types depending on their size into the following…
Q: Glucagon causes production of which activates Insulin causes production of which activates -
A: Glucagon and insulin are hormones released from alpha and bets cells of pancreas, respectively.…
Q: C. Mucic Acid Test for Galactose and Lactose describe the appearance of a few typical crystals…
A: Galactose and lactose can be found using the highly specific mucic acid test, which is used to…
Q: 1) Gluconeogenesis refers to ________. A) the breakdown of glycogen B) the formation of glucose from…
A: Generally, glucose is the preferred source of energy in our body. But of we are not eating properly…
Q: Be able to describe how the “law of mass action” drives bicarbonate formation when the blood is in…
A: In a reversible reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration…
Q: does BPG bind to deoxyhemoglobin only?why BPG does not bind to oxyhemoglobin? what is chemical…
A: Hemoglobin is a globular protein, ie it is roughly spherical. It is a tetramer of two types of…
Q: For each of the metabolic transformations (a) through (d), determine whether the compound on the…
A: The biological oxidation-reduction (redox) reaction involves the transfer of electrons from one…
Q: LO43 Identify the levels at which gene expression can be regulated in prokaryotes and eukaryotes…
A: Gene regulation is the process of control of expression genes. This process occurs by several…
Q: When muscle is at rest, creatine phosphate is produced from ATP in order to store energy. What is…
A: Most of the time, certain cellular reactions are highly endergonic reaction, that is they are…
Q: 4. If a non-science person asks you what protein folding is and how the concept is related to…
A: Enzymes are biological catalysts that increases the rate of biochemical reactions. Most enzymes that…
Q: General functions of the cytoskeleton maintains the cell shape movement of proteins and lipids…
A: The cytoskeleton is a structural framework made up of protein filaments: actin filaments,…
Q: Why should it make sense that a phospholipid molecule is larger than a carbon?
A: An atom is composed of protons, neutrons, and electrons. Same type of atoms combines together to…
Q: Several problems not applicable to synthetic drugs often influence the quality of herbal drugs -…
A: Synthetic drugs are the pure form of a compound prepared and approved by testing in several trials.…
Q: A gene for albumin has 5 exons. When the DNA from this gene is allowed to hybridize with nuclear…
A: Introduction DNA is a self replicating molecule. mRNA is formed from DNA by a process called…
Q: If the following oligosaccharide was treated with an enzyme that cleaved only a1,4 glycosidic bonds,…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: 3. After the competition, the athlete's lactic acid content is 4 mmol/l. Can this be considered a…
A: Lactate is created more quickly and cannot be removed, it builds up in muscle fibers. Lactate is a…
Q: Which of the following substances derived from lipid catabolism serves as a precursor for glucose…
A: Triglycerides are fatty acid esters of glycerol. Three fatty acids are esterified to a single…
Q: Calculate the number of moles of ATP produced from the complete oxidation of 900 g glucose in the…
A: Glucose that enters the cell produces ATP by respiration. The processes involved are glycolysis,…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…
Q: The final electron acceptor of the mitochondrial electron transport system is FAD NADH NAD+…
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: *Complete hydrolysis of glycerophospholipid yields equimolar amounts of glycerol, a fatty acid [16:1…
A: Lipids are classified into three groups as simple lipids, compound lipids, and derived lipids based…
Q: Considering that calcium and ATP are required for muscle contraction, what might explain why calcium…
A: Pyruvate dehydrogenase complex (PDHC) is made up of three subunits, called E1, E2 and E3. E1 is also…
Q: 6. Draw the cyclic structure of sucrose; encircle the acetal link; and explain why it is non-…
A: “Since you have asked multiple questions, we will solve the first question for you. If youwant any…
Q: Exam pe reaction That require energy Catabolic Allosteric site ADP+POATP Entropy increases 2nd law…
A: Enzymes are catalysts that speed up biochemical reaction. These are workable under particular…
Q: We know that ketone body synthesis occurs due to high activity of ß-oxidation in the liver. Whic of…
A: During starvation, triglycerides are broken down into constituent fatty acids and glycerol. Fatty…
Q: Considering that 21.8 kJ/mole of energy is required to transport 1 H+ across the mitochondrial…
A: Aerobic metabolism of 1 molecule of glucose can produce 10 NADH (6 from acetyl CoA in the TCA cycle…
Q: 1. Classification, structure and properties of higher fatty acids, their biological role.
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: Why does glutamate the only amino acid used in oxidative deamination
A: Glutamate is an acidic amino acid that acts as the only amino acid used in oxidative deamination.…
Q: Would increasing the concentration of glucose be a physiologically reasonable way to increase the…
A: In order to answer this question, first we need to find the intracellular concentration of glucose…
Q: How does ATP regulate the activity of PFK-1? ☐☐ ATP binds to PFK-1 at the catalytic site as a…
A: Glycolysis is a process in which glucose is oxidized & is converted to pyruvate and in that…
Q: Which of these chemicals damages the brain in a way that resembles Parkinson’s disease? A. Capsaicin…
A: Dopamine is a neurotransmitter. It is synthesised by dopaminergic neurons. Parkinson's disease is…
Q: Give a summary of your results for Food Sample 2 (Unknown). What kind of food item do you think this…
A: Benedict's test determines the presence or absence of reducing sugar in a solution. The iodine test…
Q: discuss the G-protein coupled receptors structure and overview of G-protein dependent signaling…
A: G-protein is a GTP binding protein that is found closely associated with the receptor called…
Q: He is administered a drug that inhibits bacterial enzyme that catalyzes bacterial DNA synthesis. The…
A: Enzyme inhibition is a process by which the activity of an enzyme is altered. Inhibitors are…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Citrate synthase is inhibited by: NAD+ ADP NADH oxleoacetate All of the above None of the aboveThe synthesis of acetyl-CoA from pyruvic acid serves as a bridge between which of the following pathways? glycolysis and the Krebs cycle the Entner-Douderoff pathway and the Krebs cycle CO glycolysis and fermentation glycolysis and the electron transport chain Krebs cycle and the electron transport chain uestion 21 the carbon dioxide produced during aerobic respiration is produced in the Krebs cycleOrganisms growing anaerobically cannot perform glycolysis for long without reducing the pyruvate from glycolysis into another compound, most commonly to lactate or to ethanol plus CO2. Which of the following provides the best explanation for sustaining anaerobic glycolysis? O Lactic acid has to be reduced to regenerate NADH Pyruvate has to be reduced to regenerate NADH Pyruvate has to be reduced to regenerate NAD+ Lactic acid has to be reduced to regenerate NAD+
- Under anaerobic conditions, pyruvate will be converted to lactic acid. Why does this occur? To convert NADH to NAD* to feed back into glycolysis To supply the glycolysis reaction glyceraldehyde-3-phosphate to 1,3-bisphosphoglycerate with needed electrons in the form of NADH Because lactic acid can be converted to glucose to feed back into glycolysis Because lactic acid is needed to resupply glycolysis with electrons OPlace the cellular respiration pathways in their correct locations. Oxidative Breakdown of pyruvate Glycolysis Citric acid cycle phosphorylafion Outer mhochondrial membrane Cysel 2 pnate Mitochendrial Inner miochondial membrane 2 LAD 2ADE 2 pte AD 2AOH acetyl 2CO, + 2 acetyl and FADH, via the ectron transport chain genetes an H aradiest that is sod o mute mone ATP via the ATP syathase. O, is consumed to 4 CO 2 acetyl +2 ATP +2 ATP +30-34 ATP Via substratelewl phosphorylaion Va substrate-Ievel phosphorylation Via chemioumosisIn order for an adipose cell to synthesize decanoic acid, it will need substrates in the form of _______ ATP, _______ NADPH from the transport of citrate into the cytoplasm and the subsequent recycling of oxaloacetate, and _______ NADPH from the pentose phosphate pathway. You can ignore the ATP used to regenerate mitochondria oxaloacetate via pyruvate carboxylase.
- In order to metabolize lactose, most infants express the enzyme lactase in their intestines. How many pyruvate molecules and NADH molecules can be generated in glycolysis from one lactose molecule? Please explain. How many ATP molecules will be used and generated by 1 lactose molecule? Please explain.Which of the following events does not occur during pyruvate processing (pyruvate oxidation)? One carbon atom of each pyruvate is oxidized to carbon dioxide. NAD+ coenzyme is reduced to NADH. The remaining two carbon atoms of pyruvate (acetyl unit) reacts with coenzyme A to produce acetyl CoA. FAD coenzyme receives two hydrogen atoms to produce FADH2.What is the process that sustains the redox balance of glycolysis under aerobic conditions? transport of lactate from the cell regeneration of NAD* in the citric acid cycle formation of NADH in the reaction of glyceraldehyde 3-phosphate dehydrogenase regeneration of NAD* in fermentation processes regeneration of NAD* in the mitochondrial electron-transport chain
- How is the malate shuttle used in the liver to increase the number of ATP generated from glycolysis? Contrast this with how NADH from glycolysis is dealt with in the muscle.ATP levels are high in the liver, NADPH levels are low, but fat biosynthesis needs to happen. What is the function of the pentose phosphate pathway? Mode 1 - NADPH and ribose 5-phosphate are being generated Mode 2 - ribose 5-phosphate is needed, so only the non-oxidative portion is being used for carbon skeleton rearrangments Mode 3 - NADPH is needed, so oxidative portion is operating to make NADPH and non-oxidative portion is operating to regenerate glucose 6-phosphate Mode 4 - NADPH and ATP are needed, so oxidative portion makes NADPH, non-oxidative portion does carbon skeleton rearrangements to fuel glycolysis and make ATPWhich of the following events occurs during the energy-payoff phase of glycolysis? One carbon of a pyruvate molecule is oxidized to carbon dioxide. Oxaloacetate receives a two-carbon acetyl group from acetyl coenzyme A to form citrate. Substrate-level phosphorylation Oxidative Phosphorylation In which stage of aerobic cellular respiration are FADH2 molecules produced? Pyruvate Oxidation Glycolysis Krebs Cycle Electron Transport Which of the following events does not occur during pyruvate processing (pyruvate oxidation)? One carbon atom of each pyruvate is oxidized to carbon dioxide. NAD+ coenzyme is reduced to NADH. The remaining two carbon atoms of pyruvate (acetyl unit) reacts with coenzyme A to produce acetyl CoA. FAD coenzyme receives two hydrogen atoms to produce FADH2.