Can human digest this trisaccharide?What bond is it between sugar B and sugar C?(be specific)
Q: mo Fill in this table for cortisol, aldosterone, testosterone, estradiol, parathyroid gland hormone,…
A: Hormones are chemical messengers or signaling molecules present in our bodies. They travel in our…
Q: Sample w/ water w/ pancreatin Observation Exploratory questions: 3. What type of hydrolysis is used…
A: Animal fat and vegetable oils are simple fats or triglycerides. Triglycerides are fatty acid esters…
Q: Indicate the total number of ATPs produced in each of the following oxidation reactions from 5 moles…
A: In cellular respiration, glucose is oxidized during glycolysis and the end product (pyruvate) is…
Q: There is a proposal that pyrazole could protect against the damaging effects of alcohol on the liver…
A: Alcohol toxicity happens due to excess consumption of alcohol in short period of time. Oxidative…
Q: Choose the correct answer from the options in brackets. The [positive/negative] standard…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: Given this peptide chain: LYS – MET – ASP – THR – GLN – ARG- LYS – TRP – MET – LYS – GLU – VAL- ARG…
A: Using chromatography, a compound can be separated from a mixture of compounds. There can be various…
Q: Name the compound: 1. Lys-Ile-Met-Val Draw the forms of the amino acid in the solution. 2.…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: Using Haworth projections, draw the structure of an a-disaccharide of mannose B(1,2) galactose…
A: The disaccharide of concern is made up of 2 monosaccharides; α-mannose and β-galactose. The…
Q: 1. Draw (or insert) the general formula of an amino acid and label the four components. Which one…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question for…
Q: Mucic Acid Test for Galactose and Lactose Galactose, on being oxidized with HNO3 forms mucic acid,…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified into monosaccharides,…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…
Q: Consider a protein with two surface-exposed histidine residues: HisA is a “typical” histidine…
A: The Henderson-Hasselbalch Equation for the deprotonation of a species is given below. pH= pKa +…
Q: The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5'…
A: DNA is double stranded & during replication both of its strands unwind to produce single…
Q: 2. What molecule does not bind to hemoglobin? O (a) Carbon monoxide (CO) O (b)…
A: Our red blood cells (RBCs) are composed of hemoglobin that helps to transport oxygen throughout the…
Q: 1. What role do eicosanoids play in the body? What is the primary fatty acid in their composition?…
A: INTRODUCTION : Eicosanoids - They are classified as a group of molecules which are being derived…
Q: Discuss the synthesis and utilization of ketone bodies.
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: B Which of the following is a Receptor Tyrosine Kinase? a. adenylyl cyclase b. B-adrenergic receptor…
A: Tyrosine kinases are enzyme that phosphorylates their substrate at the tyrosine residue. Tyrosine…
Q: Arrange the following in the order they appear in electron transport. a. FAD, coenzyme Q, cytochrome…
A: Electron transport chain is a series of protein and organic molecules located in the inner membrane…
Q: 3- True or False: A given reaction, such as the hydrolysis of ATP can do a set amount of…
A: Adenosine triphosphate, or ATP, is a small molecule. It can be viewed as the primary energy currency…
Q: Transcriptional initiation at defined sequences in DNA is required to ensure that the 5' end of the…
A: By forming a DNA-protein complex with a specific DNA binding protein, DNA regulatory sequences…
Q: At room temperature (20 °C), milk turns sour in about 64 hours. In a refrigerator at 3 °C, milk can…
A: A derived form of Arrhenius equation can be used to solved this problem. This equation is given…
Q: 4. Which of the following mutations would most likely keep the transitions of T state to R state in…
A: Amino acids are biomolecules that have a carboxyl group, an amino group and a side group linked to…
Q: Upon doing the experiment of Protein Denaturation, what could be observed in the precipitation of…
A: When a protein solution is boiled, the protein frequently becomes insoluble (i.e., denatured) and…
Q: He is administered a drug that inhibits bacterial enzyme that catalyzes bacterial DNA synthesis. The…
A: Enzyme inhibition is a process by which the activity of an enzyme is altered. Inhibitors are…
Q: Use the metabolite concentrations in the table to calculate the AG of the reaction above. Report…
A: Dihydroxyacetone (DHA) catalyzed into glycerol reversibly by enzyme glycerol dehydrogenase. NADH…
Q: Explain the regulation of biochemical pathways. Describe the regulation of β-oxidation. Describe the…
A: Beta oxidation is the catabolic pathway of degradation of fatty acids to release energy. Urea cycle…
Q: Use the gel image below to determine the sequence of the original DNA template strand sequenced…
A: As per the Watson-Crick model of the DNA double helix: DNA is made up of two strands of…
Q: Consider ten glucose molecules that enter a cell. How many ATP can be generated by the complete…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: Please draw 2 diastereomer of the following molecule
A: Isomers are molecules with same molecular formula and different arrangement of atoms. Isomers are…
Q: In one form of thalassemia, the mutation of a single base from G to A generates a new 3' splice site…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: Given the data in the table below and your knowledge of the "chemical standard state" (X) and the…
A: Chemical standard state is defined by standard conditions in chemical systems. These standard…
Q: QUESTION 10 You are creating a set of Daphnia mutation accumulation (MA) lines to determine…
A: The accumulation of data on the genomic bases of adaptation has reignited interest in adaptation…
Q: 15-24 b) c) Identify the molecules oxidized and reduced in the following reactions: a) CH₂CH₂CHO +…
A: Many redox reactions occur during metabolism. Redox reactions necessitate the transfer or removal of…
Q: Like other enzymes, arachidonic acid can be prevented from working by way of inhibitors. What…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: Compare and contrast glycogen synthesis/degradation in muscles as compared with the liver.
A: Glycogen is a storage polysaccharide made up of glucose units linked by alpha 1,4 and alpha 1,6…
Q: Why might a person who is gravely ill not want to participate in a placebo-controlled drug study?
A: Placebo-controlled drug study is a study done where one group of participants are given the actual…
Q: 1. Acetyl-CoA labeled with ¹4C in both of its acetate carbon atoms is incubated with unlabeled…
A: The citric acid cycle, also called as the Tricarboxylic acid (TCA) cycle is the central metabolic…
Q: hat roles do ionizable amino acids play in the active sites of enzymes
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Problem. The student conducted a chemical experiment to prove the reducing properties of maltose…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: How does ATP regulate the activity of PFK-1? ATP binds to PFK-1 at the catalytic site as a…
A: The enzyme phosphofructokinase 1 (PFK-1) catalyzes the following reaction: Fructose 6-P + ATP –>…
Q: Describe the mechanism for moving acetyl-CoA produced in the mitochondrial matrix into the cytosol…
A: An enzyme called acetyl CoA carboxylase in the cytoplasm catalyzes the carboxylation of Acetyl CoA…
Q: Please help me calculate BSA and Net Abs (explaination and details pls)
A: Bovine Serum Albumin (BSA) is the most commonly used protein in research. It is obtained from the…
Q: does BPG bind to deoxyhemoglobin only?why BPG does not bind to oxyhemoglobin? what is chemical…
A: Hemoglobin is a globular protein, ie it is roughly spherical. It is a tetramer of two types of…
Q: 1 lactose is the digestive enzyme that breaks the dissaxhrode lactose into glucose and…
A: Enzymes are usually composed of proteins which catalyzes biochemical reactions by decreasing the…
Q: Questions and Problems 7. Explain the difference in enzyme activity before and after heating. 3. Why…
A: Enzymes are high molecular weight protein molecules that catalyse biochemical reactions. The…
Q: CH2OH 바 조 он г 어 H CH2OH ㅇ 애 1 에 Beta-Derunopyranose KH H+ H2M осH2он 애 애 애 alpha- D- erunopyrunose
A: Alpha and beta forms of monosaccharide sugars are called anomers. The two forms are isomers and…
Q: What is the smallest number of molecules of ATP and GTP consumed in the synthesis of a protein with…
A: The polypeptide chin consists twenty naturally occurring amino acids that are linked together by…
Q: Coupling ATP hydrolysis to glucose phosphorylation makes thermodynamic sense, but consider how the…
A: The two individual reactions i.e. glucose phosphorylation and ATP hydrolysis is given below, along…
Q: Classification of lipids.
A: A category of heterogeneous chemical substances that are soluble in non-polar solvents are referred…
Q: 19) Why do enzymes have compact structures? (If enzymes weren't globular, then where would the…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Step by step
Solved in 2 steps with 1 images
- g) (CH3)₂ - CH₂ -CH-COOH + CH₂-CH-COOH -H₂O NH₂ OH NH₂ 4. Write the equation for the digestion (hydrolysis) of Phe-Asp-Ala. €NAZO NHZ Ala-Cys-Glu -Tyr - Trp - Lys - Arg - His -Pro-G ly Glu pka 4.15 SH Tyr 10.10 Draw Charges Lys 10.67 Olt A3 12.10 +NH₂ Ntrm 2) Calculate net charge 3) write out I letter code 300 Ctim 3 juli of peptich (above) Ⓒ pH; 1,7,12Which of the structures below is that of о-в-D-glucopyranosyl-(1->4)- a-D-glucoругanose CH2OH CH2OH H. OH он H Он OH OH CH2OH HOH2Ć OH он CH2OH CH2OH OH H он H он он CH2OH CH2 OH H OH он OH None of the other structures are correct.
- These branching differences give the polysaccharides different properties. Use the above images to describe the branching pattern. Record your description in the last column of the table below. Carbohydrate Name Glucose Fructose Galactose Lactose Sucrose Maltose Starch Glycogen Cellulose Chitin Carb Structure (Mono, Di, Poly) monosaccharide monosaccharide monosaccharide disaccharide glucose + galactose disaccharide glucose + fructose disaccharide glucose + glucose polysaccharide polymer of glucose polysaccharide polymer of glucose polysaccharide polymer of glucose polysaccharide polymer of glucose Major Source & Function Photosynthesis; acquisition from glucose stored in other animals honey, fruit, some vegetables corn (which is processed to yeidl high fructose com syrup) dairy products, avocados, sugar beets sugar cane & sugar beets many other fruits as well cooked sweet potatos, pears & honey; manufactured food stuffs like beer, bread, breakfast cereals synthesized in plants glucose…Saponify this mixed triglyceride with 3NaOHTrace the pathway of [14C]bicarbonate through gluconeogenesis. Use an asterisk to indicate the location of ¹4C in all intermediates and in the final gluconeogenesis product, glucose. HO-C O- =0 [¹C] Bicarbonate CH₂OPO H-C-OH --OPO O 1,3-Bisphospho- glycerate ↑ -COO -CH₂ TC=O coo Oxaloacetate CH,OPO H-C-OH COO ↑ 3-Phosphoglycerate CH₂ C-OPO -COO Phosphoenolpyruvate CH,OH HC-OPO, COO 2-Phosphoglycerate Answer Bank
- Tridecane [CH3(CH2)11CH3] is a major component of the repellent that the stink bug Piezodonis guildinii releases from its scent glands when attacked. What fatty acid gives tridecane on decarboxylation?D-Glucose and D-Galactose are A H D C=0 H-C-OH OH C-H H-C-OH H_C-OH CH₂OH D-Glucose ketoses epimers pentoses enantiomers H ... н-с-он OH-C-H он-с-н H-OH CH₂OH D-GalactoseModify the structures of D-glucose and D-mannose to show a-D-glucosyl-(1→6)-D-mannosamine. H с H2C ОН с Н ОН Ni/ с ОН Н C I ОН Н 0 Н с CH₂ ОН Н ОН NM! с ジミ Н NH₂ ОН C | Н C
- First letter U C A UUU UU JUC UUA UUG CUU CUC CUA CUG AUU AUC AUA AUG GUU GUC GUA GUG ] Phenylalanine UCU (Phe) UCC UCA UCG Leucine (Leu) Leucine (Leu) Isoleucine (Ile) Methionine (Met) Valine (Val) CCU CCC CCA CCG b) lysine c) methionine d) tryptophan ACU ACC ACA ACG GCU GCC GCA GCG C Second letter Serine (Ser) Proline (Pro) Threonine (Thr) Alanine (Ala) UAU UAC UAA UAG CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG ] Tyrosine (Tyr) Stop Stop Histidine (His) Glutamine (Gln) Asparagine (Asn) Lysine (Lys) Aspartic acid (Asp) Glutamic acid (Glu) UGU UGC UGA Stop UGG Tryptophan (Trp) CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG ] 1. List the mRNA base codons for the amino acids listed below. 2. a) aspartate: Cysteine (Cys) Serine (Ser) U C Arginine (Arg) A G Arginine (Arg) U C Glycine (Gly) A G U C A G U MCAG АIn the following scheme: HH, H₂C-C-C-Coo II HO H • NH, 1 H₂C-C-C-C000 H 2-Amino-3-ketobutyrate ↓ O H,C-C-CH₂-NH₂ Aminoacetone 0 0 H₂C-C-C-H Methylglyoxal H H₂C-C-COO OH D-Lactate O H₂C-C-C000 Pyruvate What molecule is being metabolized? Identify the reaction at each step. If it is an oxidation-reduction prove this is correct by showing oxidation state changes on the atoms in the structure.Identify the structure of O-a-D-sorbopyranosyl-(24)-B-D-glucopyranose below. The following structures will help: НО Н ОН х Н H H D-sorbose Н OH CH₂OH Н Н Н OH HO Н H HO H н HO ОН Н н Н О ОН O H Н CH₂OH OH OH н 0 CH2OH Н OH Н H OH Н CH₂OH H ОН Н OH Н Н Н РО OH Н HO OH н н -O CH2O Н O H H OH н Н OH CH₂OH о CHOH H H Н Ко OH H OH Н Н OH Н OH Н OH Н CH₂OH -OCHOH H OH O CH OH Н OH Н Н CH₂OH ОН он OH OH H OH H O OH CH₂OH OH ОН Н O OH OH D-glucose Н ОН Н ОН ОН