CH2OH 바 조 он г 어 H CH2OH ㅇ 애 1 에 Beta-Derunopyranose KH H+ H2M осH2он 애 애 애 alpha- D- erunopyrunose
Q: Draw a lipid structure. Properly label the polar and non-polar ends of the representation of a lipid…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: A(n) (hydrolysis, oxidation reduction, group transfer, isomerization, internal rearrangment)…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: RESULTS Table 1. Absorbance values of BSA standards. ● ● Test Tube No. BSA (μL) DDW (μL) 100 80 60…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: II. Draw the different forms of the following amino acids in solution. 1. Proline (3 forms) 2.…
A: Amino acids are basic unit of polypeptide chain. Alpha carbon of amino acids contains carboxyl…
Q: Could you help with part d? Create a speciation diagram for histidine by plotting Xi vs pH from pH =…
A: His is a basic amino acids with pKa value of its side chain ~6, amine and carboxyl groups pKa values…
Q: true/false: The cofactor ATP is essential in all transamination reactions.
A: Transamination is a reaction which results in transfer of an amino group to a keto-acid in order to…
Q: How can an unfavorable reaction (AG°¹ > 0) still occur in a metabolic pathway? By increasing the…
A: Metabolic reactions are the biochemical reactions that are essential for our cells to get energy…
Q: in a specrophotometry ethanol determination experiment, you measured OD340 and assumed this…
A: Nicotinamide adenine dinucleotide: The molecules nicotinamide adenine dinucleotide (NAD) and…
Q: When studying the mechanism of the enzymatic reaction, functional groups were found that ensure the…
A: Biochemical reactions tend to be slow because biomolecules are stable at biological pH and…
Q: How are GMOs applications of biotechnology?
A: Introduction:- The question is all about the genetic technology where genetic modification takes…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: A dipeptide is a two amino acid linked via a peptide bond. The peptide bond is formed between the…
Q: Experiment: DNA Extraction from Banana The procedures are attached below. Questions: 1. What does…
A: DNA extraction is a method to obtain the purified chunk of DNA molecule from the mixture. It can be…
Q: Catabolism - draw the complete citric acid cylcle for myristate
A: Myristate is a saturated fatty acid with 14 carbon atoms. Fatty acids are metabolized through the…
Q: Use the metabolite concentrations in the table to calculate the AG of the reaction above. Report…
A: Dihydroxyacetone (DHA) catalyzed into glycerol reversibly by enzyme glycerol dehydrogenase. NADH…
Q: Make a Concept Map about the Amino Acids. Separate them base on Essential, Non-Essential, and…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…
Q: Kinesin movement is dependent on GTP hydrolysis. True False
A: Kinesin is a motor protein that is essential for the cellular functions like mitosis, transport of…
Q: QUESTION 37 If glycogen synthase kinase-3 is active (check all that apply): O glycogen will not be…
A: Glycogen is a storage-type homopolysaccharide that contains two types of glucose polymers: amylose:…
Q: Given the data in the table below and your knowledge of the "chemical standard state" (X) and the…
A: Chemical standard state is defined by standard conditions in chemical systems. These standard…
Q: What are the qualitative tests to characterize isolated RNA?
A: RNA or ribonucleic acid, most often single stranded nucleic acid found is all living organisms is…
Q: Mechanism of action of electron transport inhibitors. Amital.
A: INTRODUCTION : First of all, there is no electron transport inhibitor called Amital, it is a wrong…
Q: Add curved arrows to show the mechanism of nucleophilic attack. Select Draw ||||||||||COH P : 0: | :…
A: A nucleophile is a chemical species that is negatively charged or has a high electron density or a…
Q: How similar of an effect would a mutation in pyruvate dehydrogenase have, compared to a mutation in…
A: In glycolysis, a 6-carbon molecule of glucose-6-phosphate is broken down into 3-carbon pyruvate by…
Q: Explain the growing public health threats of emerging zoonotic infections and challenges in…
A: Zoonoses are diseases and infections that are naturally transmitted between humans and vertebrate…
Q: f What advantage is there to phosphoglycerate kinase having an open and closed protein…
A: Glycolysis is the 10-step enzymatic conversion of 1 molecule of six-carbon glucose to two molecules…
Q: Two (2) moles of GALACTOSE are completely oxidized to CO₂ and water using the malate-aspartate…
A: Glycolysis involves a series of reactions that convert glucose into pyruvate with the production of…
Q: What are the units for KM and why does this constant have these units? In the Michaelis-Menten…
A: The general equation for initial velocity (V) of a reaction involving a single substrate on an…
Q: Both myoglobin and hemoglobin can adopt both T and R states. Both myoglobin and hemoglobin bind to…
A: Hemoglobin and Myoglobin: In terms of primary sequence, myoglobin and hemoglobin are only distantly…
Q: Use the sequence provided here to identify the tag and tag location for the encoded DHFR fusion…
A: The enzyme known as dihydrofolate reductase, or DHFR, reduces dihydrofolate to tetrahydrofolate by…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: Enzymes are proteins that act as biocatalysts. Enzymes are classified into six classes based on the…
Q: Like other enzymes, arachidonic acid can be prevented from working by way of inhibitors. What…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: catabolic pathway - draw the complete electron transport chain for myristate
A: Myristate is 14 carbon saturated fatty acid molecule (molecular formula of CH3(CH2)12COOH), a…
Q: A new protein is discovered that contains a pleckstrin homology domain. Which of the following…
A: Pleckstrin homology domain is a domain in protein and is made up of nearly 120 amino acids. It is…
Q: Calculate the mass of invertase (in mg) and concentration of invertase (in mM) contained in a…
A: Enzyme Activity =Amount of product formedtime The conventional unit used for assigning enzyme…
Q: Complex proteins-enzymes, their components. Prosthetic groups of complex protein-enzymes…
A: Complex proteins-enzymes have wide applications in metabolic activities and have many physiological…
Q: When an inhibitor blocks a step in electron transport, all of the following are true except that Oa.…
A: ETC consist of four protein complexes called Complex I, II, III and IV that transport electron…
Q: Select ALL statements that are true about the isoelectric point (pI) of a protein a.Protein carries…
A: The isoelectric point (pI) of a protein is the pH at which the protein is neutral or the overall…
Q: Find 3 reactions that facilitate the synthesis of oxaloacetate
A: The tricarboxylic acid cycle (TCA) is the metabolic pathway that generates NADH and FADH2 for…
Q: Ribose-5-phosphate is produced by oxidative decarboxylation of 6-phosphogluconate using the enzyme…
A: The pentose phosphate pathway also called the hexose monophosphate shunt is an alternative pathway…
Q: 2. Enzyme-catalyzed reactions. Answer the following with true or false. If false, explain why. (a)…
A: Enzyme is a biological catalyst, protein in nature which can increase the chemical reaction without…
Q: 3. Researchers purified a new enzyme and during an initial characterization determined the Vmax to…
A: Enzyme inhibition is when an inhibitor bind to the enzyme at the active site or another site, which…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: Identify two (2) functions of lipids in the body. Explain each function in 2 sentences.
A: Lipids are a very important class of biological molecule. Lipids are a broader class of molecule…
Q: You are studying the DNA binding protein CLAMP and you want to determine its binding affinity for…
A: Introduction DNA acts as genetic material in our body. It is a double stranded molecule. mRNA is…
Q: A pentapeptide has the abbreviation "GREAT". Draw the peptide and give its systematic name.
A: Peptides are short sequences of amino acids. Amino acids in a peptide are joined together through…
Q: 2. Another bodily process is the urea cycle. However, a carbamoyl phosphate is necessary to begin…
A: Carbamoyl phosphate is synthesized with the help of enzyme carbamoyl phosphate synthetase requiring…
Q: Which reaction or reactions of glycolysis require NAD* as a reactant? Which reaction or reactions in…
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: Maargerines made from plant oils are healthier, since they are hydrogenated for spreadability?…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: 1- Catalyzes the production of FADH, in the Krebs cycle: a) isocitrate dehydrogenase b) aconitase c)…
A: The acetyl CoA molecules that are synthesized as the end product of carbohydrate, protein, and lipid…
Q: Which of the following monosaccharide phosphates is NOT produced in the pentose phosphate pathway?…
A: In animal tissues, glucose has two possible fates: be oxidised into carbon dioxide and water by…
![Снгон
он г
он
онгон
H
сигон
Beta-D-eranopyranose
KH
он
애
\/
оснгон
애
он
он
alpha-D- eranopyrunose](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F1797707a-0d96-41d6-8f45-19c20e886f5b%2F6f7f7989-4e16-4861-83b1-c23334ce5a8e%2Fljrk9lz_processed.jpeg&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- This region performs peristalsis to move a bolus. -B DWhat kind of words are Broca’s patients least likely to use?+ www-awu.aleks.com/alekscgi/x/Isl.exe/10_u-lgNslkr7j8P3JH-IQUHIQg6bJxmeSyVPHOEB1plef9xyC5Ca9QlbCmqT-TP-BcuGkqzvM9h_eXu2dblOXnFt00g1aPGkUe7G4... с O Biological Macromolecules Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: ATGAGTATCTAA It's known that a very small gene is contained in this section. In the table below, write the base sequence for two point mutations of this DNA, one silent, and one not. Silent mutation: Non-silent mutation: Explanation Check ☐ MacBook Air 0/5 Julianna X $ 00. 园 2024 McGraw Hill LLC. All Rights Reserved. Terms of Use | Privacy Center | Accessibility
- ← EKS - Julianna Graham-L C www-awu.aleks.com/alekscgi/x/Isl.exe/10_u-IgNslkr7j8P3jH-IQUHIQg6bJxmeSyVpHOEB1plef9xyC5Ca9QIFgexGf0NiuPJK2Z8F-VEOIгMUwN0bVV3DxxX15y41LUlg-pii... Biological Macromolecules Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: ATGATTGTCTAA It's known that a very small gene is contained in this section. In the table below, write the base sequence for two point mutations of this DNA, one silent, and one not. Silent mutation: Non-silent mutation: Explanation Check MacBook Air X G 0/5 Julianna ? olo 2024 McGraw Hill LLC. All Rights Reserved. Terms of Use | Privacy Center AccessibilityWhat does the abbreviation for the patients upcoming surgery,TURP mean?A ALEKS - Julianna Graham - Lex ← -> + www-awu.aleks.com/alekscgi/x/Isl.exe/10_u-IgNslkr7j8P3jH-IQUHIQg6bJxmeSyVpHOEB1plef9xyC5Ca9Q14Cm2tjsBWHQAGXDI1R-1bkl5qCnhtVT33AObnhlvotTyU-C... ☆ O Biological Macromolecules Understanding that DNA replication is semiconservative 0/5 The template (antisense) strands of two complete (double-stranded) DNA molecules have the base sequences shown in the table below. Two replication experiments are done with each molecule: 1. In Experiment #1, samples of each DNA molecule are incubated with radioactive guanine, along with appropriate replication enzymes, ATP, adenine, thymine, and cytosine. Experiment #1 is stopped when each DNA molecule has replicated once. 2. In Experiment #2, all the DNA molecules from #1 are purified, and then incubated with again with the same reaction mixture. Experiment #2 is stopped when each DNA molecule has replicated one more time. Predict the percentage of DNA in each sample that is radioactive after each experiment. Round…
- can u help me quiklyesc A ALEKS-Julianna Graham - L x 5 Grades for Julianna Graham: C www-awu.aleks.com/alekscgi/x/Isl.exe/10_u-IgNslkr7j8P3JH-IQUHIQg6bJxmeSyVPHOEB1plef9xyC5Ca9QIC2eximg311f4UgzRAfAESBjuj6RDc7Yrn... Biological Macromolecules New Chrome available: 0/5 Julianna Naming and drawing cyclic monosaccharides Give the complete common name, including anomer and stereochemistry labels, of the following molecules. You will find helpful information in the ALEKS Data resource. H H CH₂OH 0 OH OH OH OH H OH OH HOCH₂ OH H H H OH H H носна H OH OH HOCH2 CH₂OH H H OH OH OH Explanation Check 0 80 800 F4 F3 # $ % Λ α ẞ Y 5 MacBook Air F6 & F7 olo 2024 McGraw Hill LLC. All Rights Reserved. Terms of Use | Privacy Center Accessibility * F10 F12 deleA ALEKS - Julianna Graham - Lex ← -> C + www-awu.aleks.com/alekscgi/x/Isl.exe/10_u-lgNslkr7j8P3JH-IQUHIQg6bJxmeSyVPHOEB1plef9xyC5Ca9QIC2eximg3llf4UgzRAfAEs Bjuj6RDc7Yrn0JQE5NIn-2CENI_Mk.... Biological Macromolecules Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: ATGAGGTTATAG It's known that a very small gene is contained in this section. In the table below, write the base sequence for two point mutations of this DNA, one silent, and one not. Silent mutation: Non-silent mutation: Explanation Check MacBook Air 0/5 Julianna 5 ala 2024 McGraw Hill LLC. All Rights Reserved. Terms of Use Privacy Center | Accessibility Σ
![Medical Terminology for Health Professions, Spira…](https://www.bartleby.com/isbn_cover_images/9781305634350/9781305634350_smallCoverImage.gif)
![Medical Terminology for Health Professions, Spira…](https://www.bartleby.com/isbn_cover_images/9781305634350/9781305634350_smallCoverImage.gif)