Problem. The student conducted a chemical experiment to prove the reducing properties of maltose disaccharide (Trommer reaction). Justify whether the student experimentally proved the regenerative properties of maltose? Give the structure of maltose disaccharide.
Q: You are running a size exclusion column to purify your 25 kDa protein from a lysate mixture. The…
A: Size exclusion column chromatography: As a function of their respective sizes, molecules are…
Q: Q11.3: What explains the observation that FADH2 oxidation yields one less ATP than NADH oxidation by…
A: Electron transport chain is a series of protein and organic molecules located in the inner membrane…
Q: Use the gel image below to determine the sequence of the original DNA template strand sequenced…
A: As per the Watson-Crick model of the DNA double helix: DNA is made up of two strands of…
Q: Which of the following is NOT true of DNA Methylation. A. DNA methylation is typically…
A: DNA methylation is an epigenetic mechanism by which methyl groups are transferred to the DNA onto C5…
Q: true/false: Glutamine synthetase is responsible for the synthesis of glutamine from glutamate.
A: Both glutamate and glutamine are non-essential amino acids. These are glycogenic amino acids.…
Q: What elements do lipids contain?
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: Assume that you are conducting a chain-addition polymerization using 5.47 grams of monomer (MW=…
A: The number of moles is given by the ratio of the given mass in grams to the molar mass(MW) No. of…
Q: Explain why the combined presence of polyphenol oxidase and iron greatly increase the instability of…
A: Introduction Fatty acid is one of the macromolecule present in our body. Fats and oils are composed…
Q: 4. In the space below provide a mechanism for this reaction that proceeds through the intermediate…
A: Glycolysis is the process by which one molecule of 6-carbon glucose is broken down into 2 molecules…
Q: Which of the following sequences is less favorable to find in a folded beta? Select one:…
A: Two types of secondary structures are abundant in protein: alpha helix and beta sheets. The alpha…
Q: 4. Peculiarities of hormonal regulation of glycogen metabolism in muscles and liver.
A: The glycogen synthesis mainly occurs in the muscle, and liver, using glucose-6-phosphate. The…
Q: Glycolysis is the process by which energy is harvested from glucose by living things. Several of the…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…
Q: A) List each of the five major functional classes of proteins. B) Discuss the function for each…
A: Amino acids are what makeup proteins. Protein structures are biopolymeric. Twenty amino acids are…
Q: c) 1.0 1.2 Estimate Vmax and KM for all cases. What type inhibitor is [I]? Estimate K₁ and/or Kı'…
A: Enzymes are usually comprise of protein molecules which is used to catalyzed several biochemical…
Q: 6. Biological value of glycogen breakdown in muscles and liver.
A: Carbohydrates are biomolecules that are utilized as the primary source of energy. And glucose is the…
Q: Just 15-3
A: Kequilibrium constant is the ratio of rate of forward reaction and rate of backward reaction and…
Q: Suppose a student rinses their buret with water instead of sodium hydroxide, leaving water in the…
A: Introduction The titration is a chemical process by which the quantity of one substance of a sample…
Q: draw a diagram showing the interrelationship of Carbs-Lipids metabolism
A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…
Q: Upon doing the experiment of Protein Denaturation, what could be observed in the precipitation of…
A: Protein precipitation was seen in plasma samples that included ethanol solutions above a…
Q: I. Enzyme activity can be regulated by allosteric enzymes, feedback control, and covalent…
A: Since you have posted multiple questions, we will provide the solution only to the first five…
Q: 9. PFS in erythrocytes, its biological significance, manifestations and consequences of…
A: Progression-free survival (PFS): It is "the amount of time a patient experiences the diseases but…
Q: What percentage of molecules of peptide GGGG has no ionized groups (e.g. has BOTH protonated…
A: Amino acids: An amino acid can function as both an acid and a base because of its structural…
Q: The pancreas is an organ of mixed secretion. Endocrinely, beta-cells produce the hormone insulin,…
A: Pancreas has 3 types of cells: α cells secrete glucagon β cells secrete insulin δ cells secrete…
Q: Make 2 mL of 50 fold dilution of DNA solution and sodium phosphate buffer. DNA: 400 uL Sodium…
A: Dilution is the process of lowering the concentration of a solution by adding more of solvent to it.…
Q: Muscle glycogen phosphorylase, an enzyme that provides glucose to the muscle for energy production,…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…
Q: Why does adding acetic acid to the milk improve the extraction efficiency of the pentobarbital? You…
A: In liquid–liquid (solvent) extraction, the solute partitions itself between two immiscible phases.…
Q: Draw a lipid structure. Properly label the polar and non-polar ends of the representation of a lipid…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: Name the enzymes that catalyse (a) substrate-level phosphorylation and (b) coupled reactions during…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…
Q: Which major biosynthetic pathways utilize PRPP? de novo purine synthesis lysine biosynthesis…
A: INTRODUCTION: De novo purine synthesis- it is the synthesis of complex molecules from simple…
Q: 1 ).Which of the following accurately describes substrate specificity for serine proteases? A.The…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group attached to…
Q: The Gs-alpha subunit of trimeric G proteins can function to regulate ion channels. inhibit…
A: Introduction: G-protein is a heterodimeric containing three different subunits named alpha, beta,…
Q: Pathological Constituents of Urine C3. What are ketone bodies? What conditions (or diseases) lead…
A: Urine often contains water as well as contaminants such as urea, uric acid, ions, and creatinine.…
Q: How much ATP will be produced from the Beta-oxidation of lauric acid a C 12 saturated fatty acid?…
A: Lauric acid is a saturated fatty acid with 12 carbon atoms. The molecular formula of lauric acid is…
Q: All enzymes of the citric acid cycle are located in the mitochondrial matrix, except succinate…
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: *The following reaction occurs during the glycolysis pathway: glucose-6-phosphate…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…
Q: One of your colleagues has obtained a sample of muscle phosphorylase b that is known to be…
A: Glycogen is storage-type homopolysaccharides that contain two types of glucose polymers: amylose:…
Q: A total of 7.21 g of dry mixture with a protein content of 89.2% (w/w) determined by Kjeldahl…
A: % w/w tells us the grams of analyte in 100g of mixture. Hence, a protein content of 89.2% (w/w)…
Q: 2. Complete the following for serine, tyrosine, and gylcine. a. Draw the amino acid. b. Circle the…
A: Amino acids are the building blocks of proteins. they can be classified into different groups based…
Q: How are GMOs applications of biotechnology?
A: Introduction:- The question is all about the genetic technology where genetic modification takes…
Q: In the presence of O₂ and low energy status of the cell, acetyl CoA is oxidized to oxygen O lactate…
A: Acetyl Co A is a two carbon and an important biochemical molecule which is a connecting link of…
Q: Use the sequence provided here to identify the tag and tag location for the encoded DHFR fusion…
A: DHFR fusion protein: The enzyme known as dihydrofolate reductase, or DHFR, reduces dihydrofolate to…
Q: Select ALL statements that are true about the isoelectric point (pI) of a protein a.Protein carries…
A: The isoelectric point (pI) of a protein is the pH at which the protein is neutral or the overall…
Q: Structure, localization and biological significance of glycogen.
A: Introduction Cell needs energy for various metabolic processes. Glucose breaks into pyruvate and…
Q: can you explain this again in a different way
A: ATP is produced by either substrate-level phosphorylation or oxidative phosphorylation Hydrolysis of…
Q: How do Lipids vary from other macromolecules?
A: A living cell is the basic unit of life. It is capable of independent existence (as is the case of…
Q: As Build's laboratory partner, help him determine the following: 1. maximum amount of the unknown…
A: Gel filtration chromatography is a type of chromatography in which proteins are separated based on…
Q: What statement is true regarding LDL? Because the LDL is plasma lipoproteins with a lipid bilayer,…
A: Lipoproteins are triacylglycerols, phospholipids, cholesterol, and cholesterol esters associated…
Q: Below is a Michaelis-Menten plot for a wild-type (WT) and mutant (V105A) enzyme isolated from the…
A: The best way to find out the Vmax and Km values are by plotting the Lineweaver Burk Plot (LB Plot).…
Q: After 7 rounds of b-oxidation completely converts fluorooleate into acetyl-CoA, draw the molecule…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Step by step
Solved in 2 steps with 1 images
- Bioactivity and structural novelty of Cephanolide ALong explanations are not needed. Direct answers would suffice. a. Carbohydrates can function in livings systems as any of the following, EXCEPT: i. storage of energy ii. structural and mechanical support iii. aid in cell surface recognition iv. storage of genetic information v. source of ATP when catabolized b. Which of the following structural representations best describes an open-chain monosaccharide, either an aldose or a ketose? i. Fischer projection ii chair conformation iii boat conformation iv. Haworth projectiongnment.doc?_&d x True and False Assignment.doX true or false Any condition tha x content/enforced/21069983-BL_SCI_SNC2D1-7A_993734_2122Sem3/Activity3%20Assignm BIU A - A - 2. Identify the following bonds as ionic or covalent. a) NaF b) MgCl2 c) C6H1206 d) NO2 e) CaF2 f) LiF 3. Complete the following table. Electron transfer Lewis diagram Atoms to be bonded Li & CI !!!
- I. Buffer Preparation A researcher in Biochemistry is isolating α-glucosidase enzyme from malted wheat flour. The protocol requires the use of 2.00L of 0.225 M of lactate buffer with pH of 4.25. How will he/she prepare this buffer from 2.00 M lactic acid solution and solid sodium lactate (NaC3H5O3) The Ka of lactic acid is 1.38 x 10-4. [ Na=23.0, C=12.0, H=1.01, O=16.0 g/mol]arey.hoote. C Campus Student Apex Leaming O My Account-Study.. co Duolingo - The worl.. K Play K stry Study Guide D O ls Add-ons Help Last edit was 5 minutes ago BIUA Dellus 12 +. 13. What is the name of the process that combines monomers like monosaccharides to form polymers anda water molecule is lost? 14. What is the name of the process that breaks down polymers back into monomers when water is added? 15. What is the main function of polysaccharides (like cellulose) in plants? 16. a) What is the relationship between the nucleotides, nucleic acids, and DNA? b) How do nucleotides provide nucleic acids with specific codes? hp16-24 diastereomers? Explain your answer. Both? when the motecue hasonly che stereocenter then the epiners are encintomers. When the molecule hastwo umor ster Draw Haworth projection formulas for dimers of glucose having the a B1-4 linkage (both molecules of glucose in the B form) a) b) c) an a,a (1-1) linkage a B1-6 linkage between 2 ß-glucose units epime are dia ster
- Search .l 7:15 AM < Вack Assignment #1-1.docx 34. The isomer of alanine shown below is one of the 20 naturally occurring amino acids that are used to make proteins. Amino acids like alanine exist at neutral acidity (pH = 7) in the following form: :0: H3C- NH3 35. What would be the structure of alanine if HCl(aq) was added to lower the pH = 1? What would be the structure of alanine if NaOH(aq) was added until the pH = 12? 36. Write an equation to show the reaction between ethanol, C,H,OH and methyllithium, CH,Li. Draw all non-bonding electrons and show electron flow with curved arrows. 37. Write an equation that shows the reaction between acetic acid (CH,COOH) and triethylamine (CH;CH,),N. Draw all non hondina lona elaotron naira ond chow the olootron flouu Dashboard Calendar Тo Do Notifications InboxLong explanations are not needed. Direct answers would suffice. ***kind of in a hurry so having the answer asap would greatly be appreciated, thank you :)) a. Which of the following is FALSE about sucrose? i. It is a non-reducing sugar. ii. It is the transport sugar in plants. iii. It is a disaccharide. iv. Its monosaccharide units are linked via glycosidic bond α1→β1. v. It is composed of glucose and fructose. b. How many carbon atoms are found in the smallest molecules that can be classified as carbohydrates? i. 5 ii. 2 iii. 1 iv. 4 v. 3what is lactose intolerance ? describe the molecular life cycle for this disease. also describe how it occurs in a molecular level detailed mechanism. what causes this disease and how it develops ? provide detailed biochemical phenomena and life cycle for Lactose Intolerance condition.
- Help please. MD ordered morphine SO4 gr 2/5 and the pharmacist has a stock solution of gr 1/8 per milliliter of morphine SO4. How many milliliters of the stock solution is required to fill the Rx?Need both answer ASAP. 1.Draw the structure of pppUCGAP ribonucleic acid in the ionic form that would predominate at pH 7.0. 2.Draw the structure of ppTGACpp deoxyribonucleic acid in the ionic form that would predominate at pH 7.0.Assignment on KetohexosesConstruct the structure of the following enantiomers or mirror images:1. D and L Fructose2. D and L Allulose3. D and L Sorbose4. D and L Tagatose