Germline editing affects only somatic cells. True False
Q: An individual developed a condition characterized by progressive muscular weakness and aching muscle…
A: This shuttle functions in the transporting the fatty acids present in the cytosol to the…
Q: a) Which catalytic mechanism occurs in step 2? b) Why must phosphate first bind to succinyl-CoA…
A: Glycolysis, TCA cycle, and ETC all are interconnected processes. Respiration is an oxidative…
Q: normone with its blood concentration inereased during physical
A: Growth Hormone is the hormone which increased with its blood concentration increased during physical…
Q: (8) B-ketothiolase is a multifunctional enzyme in lipid catabolism. Which of the following is NOT…
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…
Q: What is the name of proteins that hold DNA in coils or V shapes in Bacteria?
A: SMC : SMC is structural chromosome maintenance .These complexes belongs to the family of ATPases…
Q: In the RBCs of the patient in the picture, which of the following would be expected? Explain. A.…
A: Red blood cells (RBCs) are the blood cells, which help to carry oxygen from the lungs to the tissues…
Q: 4. Since pepsin is a gastric enzyme, does it have an acidic or alkaline optimum pH? What happens to…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Draw a Lineweaver-Burk plot for these data. Put both sets of data on the one graph, use a different…
A: If an enzyme follows Michaelis-Menten Kinetics, a plot of the reciprocal of the reaction velocity…
Q: Draw the dipeptide that results when a peptide bond is formed between the two glycine molecules…
A: Introduction: Amino acid is a compound that contains an amino and a carboxyl group and a side-chain…
Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: running the reaction at 83 °C cooling the reaction to 11 °C changing the pH to 5.4 Increase reaction…
A: The rate of an enzyme catalyzed reaction depends on various factors like temperature and pH of the…
Q: 2. Biosynthesis of thyroid hormones. Proteins: A. Thyroglobulin with DIT. B. Thyroglobulin with T C.…
A: As shown in the given figure, thyroid hormone synthesis occurs in following steps: iodide (I-)…
Q: a) Lock and key model versus induced fit model of enzyme activity. (b) Competitive and…
A: Introduction: All the biochemical reactions are enzymes catalyzed in a living organism. Enzymes are…
Q: DNA Leading strand: 5' AAA ATA | CGC TTT|TTA ATT| AAC CCC GGG 3' A | B| C I D Exons: A, C, D…
A: The Central Dogma of Molecular Biology states that the genetic information stored in DNA is first…
Q: The DNA and associated proteins of a eukaryotic chromosome are called Chromatin Chromatosome…
A: Eukaryotic chromosomes are made up of DNA that is tightly coiled around histone protein clusters.…
Q: A biological Claisen reaction occurs in the conversion of two acetyl CoA molecules to one…
A: Introduction: The condensation reactions involve the formation of new carbon-carbon bonds. The most…
Q: Please explain how did this reaction happened.
A: Molisch's test is a qualitative test used to detect the presence of carbohydrate in a sample. In the…
Q: Xanthoproteic Test (+) Millon's Test (-) Pauly Test (+) Biuret Test (-) Which peptide will yield the…
A: Polypeptides are amino acids linked together by peptide linkages.
Q: How many more acetyl CoA are generated from stearic acid than from linoleic acid during beta…
A: The process of beta oxidation of stearic acid yields two distinct products and these are acetyl-CoA…
Q: Which polymerase transcribes genes with internal control regions (ICR)? ORNA Pol I RNA Pol III RNA…
A: DNA sequences located within the coding region of eukaryotic genes that bind regulatory elements…
Q: What is the difference between the two salt precipitation methods: salting in and salting out?…
A: The solubility of a protein in solution depends on the concentration of the salt present in…
Q: The table below summarizes the results for Millon's test. Provide the correct remarks from the…
A: The amino acid tyrosine has a side chain containing a phenol group.
Q: Consider an enzyme (P) that gets activated by forming a dimer (P2): 2P P2 At 25 °C, we have AH- 19…
A: ∆Ho is change in enthalpy of the protein activation= 19KJ/mol, it is the heat content of the given…
Q: Aldolase is a key enzyme in glycolysis that catalyzes the cleavage of its substrate,…
A: During glycolysis, Aldolase catalyzes the cleavage of its substrate fructose-1,6-bisphosphate into…
Q: Some protein kinases are inactive unless they are phosphorylated on key serine or threonine…
A: The activity of many proteins are modulated by post-translational modification of the proteins.
Q: Which of the following is not a similarity between prokaryotic initiation and eukaryotic initiation?…
A: Translation is a process of Synthesis of polypeptide chain from mRNA template by using Ribosomes. It…
Q: Fill out the table below. Determine whether the rate of the metabolic pathways will increase or…
A: Regulation of blood glucose is largely done by endocrine hormones , through a negetive feedback…
Q: Sample Results Remarks Glycine A Egg white B Casein Tyrosine D
A: In a polypeptide chain the amino acids are linked together via peptide linkages.
Q: the structure of a soap molecule, use the concept of intermolecular forces to explain why we use…
A: Soap molecules has hydrophilic head and a hydrophobic tail, they are composed of long chains of…
Q: 5. What molecules are missing from boxes in the gluconeogenesis reaction shown below 203PO- OPO,2…
A: H2O
Q: Insulin Glucagon Glycolysis Hexose monophosphate pathway Gluconeogenesis Glycogenolysis
A: Insulin is a hormone made by our pancreas. It controls the amount of glucose in our bloodstream at…
Q: 4. During a lunch at a McDonald's outlet, an office employee received about 350 g of carbohydrates…
A: for you. If you want a specific question to be answered then please specify the question number or…
Q: Describe the roles of calcium in the cell, and the mechanisms that the cell uses to control…
A: Calcium is a vital nutrient that aids in the mineralization of the skeleton. Over 99 percent of the…
Q: Carbon monoxide is lethal at low concentrations yet it plays an important role in cell signalling…
A: During the breakdown of heme, carbon monoxide (CO) is continually created in mammalian cells. CO is…
Q: HbA1c is used to monitor blood glucose levels because hemoglobin is the only protein in blood that…
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: Consider 41 NADH and 19 FADH, molecules funneling electrons into the electron transport chain…
A: Oxidative phosphorylation is the end point of energy-yielding metabolism in aerobic organisms. It…
Q: List down the specific functions of the component structures of mitochondrion relative to cellular…
A: The mitochondrion is a membrane-bound organelle. It is called as powerhouse of the cell, it plays a…
Q: water using concurrent exchange, rather
A: Maximum concentration of oxygen in blood as it leaves the Gill capillaries will be 50 mm Hg. Maximum…
Q: importance of nutrition
A: Nutrition is the biochemical process by which an organism eats a healthy and balanced diet through…
Q: What is cryopreservation? How do we reduce the risk of cell damage from osmolytic pressure in…
A: Cryopreservation is primarily used to preserve biological specimens. Individual cells and biological…
Q: calculate the net charge of your peptide at I) pH 2.0; ii) pH 6.0 iii) pH 7.0; iv) pH 11.5. show…
A: Amino acids contain ionizable groups, the ionic form of the amino acids depends on the pH. The…
Q: Describe surroundings at home which reminds you about biochemistry and relate the situation to…
A: Food is the source of macronutrients and micronutrients required for the body. During the process of…
Q: 3- Planning, implementation and evaluation
A: Health Sector is the most important sector of today's world which includes which includes hospitals,…
Q: c. Ribulose 5-phosphate levels would decrease. d. NADH to NAD+ ratios would decrease. e.…
A: In the RBC's of the patients certain changes are observed. Ribulose 5 Phosphate levels would…
Q: Explain the correlation between fasting and gluconeogenesis in terms of the hormone released by the…
A: From the non-carbohydrate source, glucose is synthesized called gluconeogenesis. It is a…
Q: 6. Describe the salient features and functions of phospholipids
A: Phospholipids or phosphatides are molecules which belong to the class of lipids has hydrophilic…
Q: What is substrate-level phosphorylation? 2. Although oxygen does not participate directly in the…
A: ATP is the energy currency of the cell and is praoduct of catabolic pathways that is used in…
Q: Match the items on the diagram with the correct term below. 3' 5' 5 D 8 Activate W DNA Replication…
A: DNA replication is the particular process by which a specific molecule of DNA is being duplicated.…
Q: 3. Which of the following is not a part of relative substrate specificity? a) Group specificity b)…
A: Enzymes are proteins that assist the bodies speed up chemical processes. Enzymes act on substrate…
Q: Please explain what happened in the reaction. How did H2SO4 and 3H2O reacted with the glucose?
A: Carbohydrates are polyhydroxy aldehydes or ketones or compounds that yield them on hydrolysis.…
Step by step
Solved in 2 steps
- Fluorescence in-situ hybridisation (FISH) analysis can be performed on fixed pathological tumour sections. Briefly outline why interphase FISH is used on fixed material from a solid tumour, rather than metaphase FISHThe vector shown is used introduced into E. coli cells. When the resulting cells are cultured, will the colonies glow under UV lights? ori bla araC pGLO GFPWhat is mRNA vaccine and how do mRNA vaccines work in our body. It is very important please give me full depth answer. I really need it.
- Following is the data and notice that it is a terrible idea to culture hMSCs longer than 10 days. You’re strongly Days # cells0 50001 75002 125003 125004 218005 287006 530007 1143008 1653009 19200010 19200011 11680012 8950013 8830014 78300 Part1 You are working for a start-up that is pursuing a clinical trial. The trial involves grafting hMSCs intopatients suffering from interveterbral disc disease using a degradable polymer scaffold. You are going to 3Dprint a porous cylindrical scaffold that is 2 cm in radius and 1 cm in height (matching the dimensions of adegenerated disc). Assume a porosity of 50%. You will fill available volume of the scaffold with hMSCs at adensity of 1 million cells per cm3. Based on the data above, what starting number of cells will you use andhow long will it take you to get enough cells for the trial? Part2The trial is a failure (patients did not report any reduction in back pain). Your team wants to try againusing 85% hMSCs and 15% nucleus pulposus cells .…Select all that may apply. What is the purpose of incubating the lambda phage/E.coli mixture at room temperature for 20min? Incubation at room temperature inactivates the cI repressor. During incubation at room temperature the lambda phage will enter the lytic cycle. Incubation at room temperature allows for the absorption of lambda phage Incubation at room temperature will allow the lambda phage to remain in the lysogenic cycle.Please help me answer this reviewer. Write the word TRUE if the statement is correct and if not, underline the word or statement that makes the sentence incorrect and write the correct answer on the space provided. 1. CRISPR refers to the repeated sequences located in the viral DNA. answer: 2. In CRISPR, the guide RNA is designed to find and bind to a specific sequence in the DNA. answer: 3. PCR makes it possible to obtain multiple copies of DNA fragments from an extract. answer: 4. DNA is positively charged. answer: Thank you very much for your help
- The ____ plasmid contains genes for synthesizing connections between donor and recipient cells.pls do not copy paste Explain the steps of preparing a cell culture stock from a T25 flask.Provide the SIGNIFICANT difference between the terms provided in the table below. Missense Nonsense Based Excision Repair Mismatch repair Point mutation Frameshift mutation Intercalating agents Alkylating agents Deletion Duplication Turner syndrome Down syndrome Translocation Inversion Muscular Dystrophy Burkitt's Lymphoma Transition Transversion Somatic mutation Germline mutation
- I AM TRYING TO IDENTIFY THIS UNKNOWN. IMAGE 1 HAS TWO PICTURE OF CATALASE TEST AND BLOOD AGAR TEST. I BELIEVED THAT THIS IS " S. PYOGENES. SO I DID A BACITRACIN TEST ON IT. IMAGE 2 SHOWS BACITRACIN TEST IMAGE. ** PLEASE HELP ME IDENTIFY IF THIS IS S. PROGENES AFTER LOOKING AT ALL THE THREE. BACITRACIN SHOULD BE THE CONFIRMATION TEST. IF YOU THINK THAT THIS IS S. PYOGENES AFTER LOOKING AT THE BACITRACIN TEST, THEN PLEAE EXPLAIN HOW DID YOU FIGURE IT OUT FROM THE CONFIRMATION THAT THIS IS S. PYOGENESE FROM BACITRACIN TEST. NEED VALID REASON WHY YOU BELIEVE IT IS S. PYOGENESWhy this term is used - malignant ?The figure depicts five stages of the lytic cycle. ********* Select the statement that describes stage 3 of the lytic cycle, as shown in the diagram. The host cell synthesizes cellular proteins to prepare for lysis. The host cell incorporates phage DNA into its own genome. The host cell replicates the phage DNA. O The host cell synthesizes proteins that degrade phage DNA.