Microbiology With Diseases By Taxonomy (6th Edition)
6th Edition
ISBN: 9780134832302
Author: Robert W. Bauman Ph.D.
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 1, Problem 1CM
Using the following terms, fill in the following concept map that describes what microbiologists study. You can also complete this and other concept maps online by going to the MasteringMicrobiology Study Area.
Acellular
Algae
Animal-like
Archaea
Bacteria
Eukaryotes
Molds
Multicellular
Obligate intracellular
Protozoa
Unicellular
Yeasts
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A professional microbiologist is least likely to study which of the following organisms?
A large bacterium like Epulopiscium fishelsoni that is visible to the naked eye
A small single-celled eukaryote like Plasmodium falciparum
Pyrococcus furiosus, an extremophilic Archaeon
Human egg and sperm cells
I studied microbiology in the fifth semester of medical school. I studied medical
mycology as one of the sub-divisions of microbiology. Medical mycology covers
human diseases caused by
protists
fungi
birds
parasites like plasmodium, schistosoma, amoeba
insects like lice
algae
You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below:
>UnknownSequence1
GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC
GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT
Chapter 1 Solutions
Microbiology With Diseases By Taxonomy (6th Edition)
Ch. 1 - What does the science of microbiology study?Ch. 1 - Are most microorganisms harmful or harmless to...Ch. 1 - Patty is a mother to 14-year-old twins and works...Ch. 1 - What scientific device did van Leeuwenhoek create?Ch. 1 - Prob. 2MICCh. 1 - Van Leeuwenhoek described bacteria, archaea,...Ch. 1 - All eukaryotic cells contain most of their genetic...Ch. 1 - What term describes the idea that living organisms...Ch. 1 - The investigations of which researcher finally...Ch. 1 - Today we understand that yeasts and bacteria can...
Ch. 1 - What industry has the work of Pasteur most...Ch. 1 - Which researcher ultimately gave us a method for...Ch. 1 - Which researcher developed the staining technique...Ch. 1 - Prob. 11MICCh. 1 - The use of antiseptic chemicals during surgical...Ch. 1 - Prob. 13MICCh. 1 - Some people consider Leeuwenhoek the Father of...Ch. 1 - Why might Nightingale be considered the Mother of...Ch. 1 - Prob. 3TMWCh. 1 - In the late 18th century, Philadelphia was one of...Ch. 1 - Emerging Disease Case Study Variant...Ch. 1 - Prob. 1MCFUCh. 1 - Dr. Andrews has a lot of questions tot Patty. When...Ch. 1 - Which of the following microorganisms are not...Ch. 1 - Prob. 2MCCh. 1 - In which habitat would you most likely find...Ch. 1 - Of the following scientists, who first promulgated...Ch. 1 - Which of the following scientists hypothesized...Ch. 1 - Prob. 6MCCh. 1 - Prob. 7MCCh. 1 - Prob. 8MCCh. 1 - Prob. 9MCCh. 1 - The laboratory of Robert Koch contributed which of...Ch. 1 - Prob. 1FIBCh. 1 - Prob. 2FIBCh. 1 - Chemotherapy _______________Ch. 1 - Prob. 4FIBCh. 1 - Infection control _______________Ch. 1 - Prob. 6FIBCh. 1 - Epidemiology _______________Ch. 1 - Biotechnology _______________Ch. 1 - Prob. 9FIBCh. 1 - Why was the theory of spontaneous generation a...Ch. 1 - Discuss the significant difference between the...Ch. 1 - List six types of microorganisms.Ch. 1 - Defend this statement: The investigations of...Ch. 1 - Why would a macroscopic tapeworm be studied in...Ch. 1 - Describe what has been called the Golden Age of...Ch. 1 - List four major questions that drive...Ch. 1 - Prob. 8SACh. 1 - Prob. 9SACh. 1 - What does the term HAI (nosocomial infection) have...Ch. 1 - Match each of the following descriptions with the...Ch. 1 - Prob. 1VICh. 1 - Prob. 2VICh. 1 - If Robert Koch had become interested in a viral...Ch. 1 - In 1911, the Polish scientist Casimir Funk...Ch. 1 - Haemophilus influenzae does not cause flu, but it...Ch. 1 - Just before winter break in early December, your...Ch. 1 - Design an experiment to prove that microbes do not...Ch. 1 - Prob. 6CTCh. 1 - Compare and contrast the investigations of Redi,...Ch. 1 - If you were a career counselor directing a student...Ch. 1 - A few bacteria produce disease because they derive...Ch. 1 - How might the debate over spontaneous generation...Ch. 1 - French microbiologists, led by Pasteur, tried to...Ch. 1 - Why arent Kochs postulates always useful in...Ch. 1 - Albert Kluyver said, From elephant to ......Ch. 1 - The ability of farmers around the world to produce...Ch. 1 - Prob. 15CTCh. 1 - Using the following terms, fill in the following...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Select the organism that matches each description. Some answers may be used more than once, and some not at all. Make sure that you scroll in the selection box, there are 13 possible matches. Was on Romaine lettuce sent from Yuma, AZ causing food-borne diarrhea Forms chains of Gram positive cells and is a common cause of tooth decay. A member of the normal vaginal flora that can overgrow at high pH Protozoan that is resistant to normal levels of chlorine used to disinfect the water Is salt tolerant and can inhabit the skin of healthy individuals, but can cause furunculosis Known as group B streptococci, is beta hemolytic and CAMP test positive Protozoan in stagnant water causing primary amoebic meningitis Psychrotropic, Gram positive rod transmitted in dairy causing systemic disease Escherichia coli O157:H7 Streptococcus pneumoniae Candida albicans Pseudomonas aeruginosa Cryptosporidium parvum Streptococcus mutans Streptococcus agalactiae Staphylococcus aureus Campylobacter jejuni Aarrow_forwardMatch the following with the choices on the right Bacteria 1. Eukaryotic photosynthetic organisms that are not plants 2. Nucleic acid in a protein coat 3. An infectious particle that is a protein Archaea Fungi Protozoa Algae Platyhelminthes Nematoda Viruses Viroids 4. Prokaryotes, usually with peptidoglycan Prions cell wallsarrow_forwardComplete the sentences with the matching vocabulary term Terms: -lytic -gram negative -aerotolerant anaerobe -ether -facultative aerobe -enveloped virus -prion -peptidoglycan -pseudopeptidoglycan -chemo heterotroph -obligate intracellular parasite -facultative anaerobe -lysogenic • A ______ bacterium will have a thin cell wall covered with an internal membrane. • A pathogen that cannot survive outside the host cell is a(n) _____. • An aerobic organism that can switch to anaerobic respiration when necessary is known as a(n) ______. • The bacterial cell wall is made of ______. • A phage that kills the host cell after one round of viral replication is referred to as a _____ phage.arrow_forward
- consider the following terms: Envelope Fusion Gene therapy Pathogen Vaccine Capsule Decomposer Epidemic Mold Spore Yeast Choose 2 terms from the list and answer the following questions for each term: What familiarity and prior knowledge do you have about the term? What does the term mean in everyday language to everyday people? Use examples to help describe your thoughts. How do people use the word? What does the term mean in technical language to biologists? How is the term related to the course student learning outcome: Describe classifications of biological diversity? What are the similarities and differences between the everyday and technical meanings and uses of the term? What impact might the similarities and differences have on your learning of biology concepts in this course?arrow_forwardgo to the website https://www.nature.com/immersive/d42859-019-00041-z/index.html and scroll up and down to review the milestones associated with microbiota research. Answer the questions/ prompts below. Bacteria and our brain? Read the information associated with this milestone and what was discovered. Briefly describe what they found...Milestone/year? What milestone is associated with the debate about when the microbiome is first established? Why is there a debate? Watch the video just below the milestone. What specific type of gene analysis was used to determine that we have our own unique microbiome? Which milestone/year? Sometimes we need antibiotics...this milestone discusses how long it can affect us after infection. In this milestone they discussed how long we could be affected by one course of antibiotics...how long? Which milestone/year? Find the milestone associated with a highly motile bacteria. What disease was treated? How was this treatment used for a…arrow_forwardChoose 1 (ONE) Protozoa per Class. Create a table indicating the following information: Mode of Image/ Class Subclass (if applicable) Name of Organism Disease Transmission Sketcharrow_forward
- Which of the following examples specifically apply to binary fission (growth)? An increase in the size of an individual Streptococcus pyogenes cell An increase in the rate of mitosis in Trichomonas vaginalis infections All of the answers apply to binary fission An increase in the number of extracellular EB forms in Chlamydia infections An increase in the size of a specific population of E. coli, an extracellular bacterial pathogenarrow_forwardAnimal Taxonomy (Protista) Comparison Intermediate Euglena Trypanosoma Plasmodium Paramecium Amoeba host Definite host Habitat Disease Vector Infective stage locomotion Feeding Reproduction Major characteristics Life cyclearrow_forwardDraw and label the typical life cycle of a Basidiomycete and upload it here. Be sure to include all terms used in this lab that apply. nved Formal Took ble Edit View МacBoo. esc C Search or type URL # $4 1 3 4 Q W Rarrow_forward
- Hello good day, I hope today has been kind to you. So I am having a problem answering this question and I need your help. Hoping for a response and thank you so much. Instruction: The answer must be in 2 paragraphs and each paragraph must have a minimum of 4 sentences. In addition, please indicate your source(s). Thank you so much. Question: How are parasites classified?arrow_forwardWHICH ORGANISM CAN MOST LIKELY BE CLASSIFIED IN THE DOMAIN BACTERIA? Required to answer. Multiple choice. A predatory organism that depends on hunting plant eaters for food a multicellular organism that reproduces via sores and gets food from a dead log a photosynthetic organism that undergoes sexual reproduction and produces seeds in a cone A unicellular organism that has a simple structure and is commonly found in the intestinesarrow_forwardDescribe the three major domains of life: Archaea, Bacteria, and Eukarya. Explain what the three domains have in common and how they differ. Define viruses, and explain how they relate to living cells. Explain how microbial diseases have changed human history. Explain the tenets of Cell Theory Describe how microscopy led to the Germ Theory of infectious disease Define the germ theory of disease. Explain how Koch's postulates can show that a specific kind of microbe causes a disease. Explain the problems in interpreting Koch's postulates in practice.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Parasites: Protozoa (classification, structure, life cycle); Author: ATP;https://www.youtube.com/watch?v=V4iSB0_7opM;License: Standard youtube license