You have been asked to identify an unknown bacteria that has been determined to be the cause of a nosocomial outbreak in your hospital. After isolating the organism, Gram stain results determine it to be a gram-negative rod that is capable of fermenting glucose but not lactose. The SIMS test also came back as negative for indole and sulfur reduction. Which of the following tests should you run next for finaj identification of the bacteria? Check All That Apply MRVP Starch Test Citrate Catalase Test
Q: What is the purpose of flaming an inoculating loop? How will you know when you have flamed the loop…
A: Hi, since you have posted multiple questions, we will be providing you with answers for the first…
Q: "If you find purple colonies with metallic green sheen growing on your EMB plate following an…
A: Introduction : Gram-negative bacteria can be identified using the selective stain Eosin-Methylene…
Q: Noah wanted to transfer Staphylococcus aureus from a broth to an agar plate. He picked up the broth…
A: The aseptic techniques are applied in the laboratory setup to reduce the risk of contamination. It…
Q: Which of the following tests can be used to distinguish between group D streptococcus and other…
A: Group D is the classification of streptococcus bacteria. These are gram positive bacteria, have…
Q: Which of the following water quality assay methods produce the greatest amount of biohazardous…
A: Introduction A biological hazard, often known as a biohazard, is a biological substance that…
Q: Kousei works at a company that produces sweetened condensed milk. If one or more samples exceed 10…
A: Cell count: The cell count data is generally utilized to predict the number of living microbes…
Q: The number of bacteria in saliva samples was determined by collecting the saliva, making serial…
A: Microorganisms are minute organisms that cannot be seen by naked eyes. They can be visualized only…
Q: If a yellow halo is present around a colony on a mannitol salt agar (MSA) plate, the bacterium…
A: Mannitol salt agar (MSA) is used as a culture medium or growth medium. Growth medium is a medium…
Q: EXPLAIN THE PURPOSE OF THE METHYL RED AND VOGES-PROSKAUER TESTS IN DETERMINING THE IDENTITY OF GRAM…
A: Enterobacteriaceae are the group of various gram-negative bacteria that are responsible for various…
Q: A stool specimen of a patient with severe diarrhea was cultured ina series of specialized media for…
A: The hydrogen sulphide H2S production test is done for the exposure of hydrogen sulphide (H2S) gas…
Q: A bacterial culture was grown for 12 hours. At 4-hour interval, the culture was sampled to determine…
A: To keep the number of colonies on the plate within a certain range, serial dilutions of culture are…
Q: You were given a mixed nutrient agar broth culture of bacteria 1a. How will you determine the…
A: A mixed bacterial culture consists of more than one bacterial cell types growing together. On the…
Q: If a yellow halo is present around a colony on a mannitol salt agar (MSA) plate, the bacterium…
A: Manitol Salt Agar (MSA) in used in lab, mostly for selective and differential growth of microbial…
Q: You were tasked to determine the total microbial load of a bread sample. The sample was homogenized,…
A: Question: Draw a schematic diagram illustrating the proposed experimental setup described above?
Q: The statement, “In the laboratory, a sterile inoculating loop is moved across the agar surface in a…
A: The technique is streak plate technique. Streak plate method is a pure culture technique which helps…
Q: How do eosin-methylene blue (EMB) agar plates work? What organism(s) are they designed to detect?…
A: Several tests are performed in the laboratory in order to detect several bacterial agents as well as…
Q: You have been asked to determine the bacterial count in a sample of water. The number of CFU from 1…
A: The CFU count is the number of viable cells per ml of the sample. The CFU count is done on the basis…
Q: After running a novobiocin sensitivity test, the zone of inhibition diameter measured 14 mm for one…
A: The microbiology studies about both the diseases causing microbes and beneficiary microbes, about…
Q: You are given a mix culture of S. aureus,E. coli and P. aeruginosa. Besides the streak plate method…
A: Microbiological research necessitates the use of pure cultures. Spreading bacteria on the surface of…
Q: You inoculate a species of bacteria on a MacConkey agar. It normally shows positive for growth and…
A: MacConkey agar is a selective differential indicator to isolate gram-negative and enteric bacteria.…
Q: Mannitol salt agar is often used to distinguish between different species of Staphylococcus, a gram…
A: Mannitol agar medium is used as selective media to select most gram positive bacteria and some gram…
Q: In spread plate method, inoculating loop is used to spread bacteria from the inoculation site. For…
A:
Q: acillus cereus bacteria, in staining reaction tests, such as A.simple staining B.gram staining C.…
A: Answer
Q: A stool specimen of a patient with severe diarrhea was cultured in a series of specialized media for…
A: E. coli is part of the normal flora of the human intestines.
Q: you are given a mix culture of S aureus, E. coli and P. aeruginosa. besides using the streak plate…
A: The first requirement for physically isolating a bacterium is that it can be cultured in the…
Q: Once the completed test establishes the presence of coliforms in the water sample, why might you…
A: Water is tasteless, transparent, inorganic. Colorless, and odorless chemical substance. Its chemical…
Q: You were tasked to determine the total microbial load of a bread sample. The sample was homogenized,…
A: Serial dilution is a step-wise dilution of microorganisms in the solution. The dilution factor…
Q: which of these tests (i.e gram stain, acid fast stain, endospore, oxidation to fermentation,…
A: A dichotomous key is a tool made by the scientist to identify any living being based on its…
Q: The following data were obtained from pour plates used to test the effectiveness of a food…
A: A colony-forming unit is the number of viable or alive cells in cell suspension that have the…
Q: what is your initial assumption of the organism causing this disease
A: Bacteria are the prokaryotic microorganism and based on the structural cell walls, Gram stain…
Q: You want to isolate staphylococci from a clinical sample, as you suspect the patient nas an…
A: Staphylococcus aureus : It is gram positive , round shaped bacteria and is a usual member of…
Q: You were asked to prepare a dilution series of a bacterial culture where only 3 tubes will be used…
A: "Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: If so, are these colonies the same color as the agar, or are they are a distinctly different color?…
A: Eosin Methylene Blue (EMB) agar isa selective and differential culturemedium. Hektoen Enteric Agar…
Q: What would be the expected out come of a gram staining test If the bacteria is a pathogenic…
A: Gram staining is a common technique used to differentiate two large groups of bacteria based on…
Q: You are a group of microbiologists tasked to test the presence of coliforms in the newly built water…
A: Coliform is a broad term used for gram-negative, rod-shaped, motile or immotile bacteria that are…
Q: A culture of Staphylococcus of unknown density is diluted as follows (letters represent each step):…
A: In a microbiology lab - food or environmental - samples are regularly diluted to find out the…
Q: The Kirby-Bauer test examines the effectiveness of antibiotics and disinfectants or antiseptics on…
A: Zone of inhibition It is the circular shape area around the antibiotic tablet placed in a culture…
Q: Create a flow chart to perform the required tests to identify unknown microorganism: - Use at least…
A: Introduction :- Micro-organisms are classified into different categories on the basis of the…
Q: You are testing for Escherichia coli in the sample. What media would you use? and Describe typical…
A: A medium in microbiology is defined as a solid or liquid substance used to culture the…
Q: I tested organism growth on the MSA plate for strep. pyongenes, strep. pneumonia, s. aureus, and…
A: Selective media is a type of growth media which selects a certain type of microorganism to grow and…
Q: Clear tubes in the MIC test were inoculated in Mueller-Hinton Agar to determine the MBC of the…
A: MBC - stands for minimum bactericidal concentration It is the lowest concentration of antibiotics…
Q: Using your fingers, you are asked to aseptically touch the surface of a sterile agar plate.…
A: The aseptic technique of plating on an agar plate means that a sterile or no infection-containing…
Q: A mixed sample is collected from a salty environment. Stapnylococcus What is the expected result and…
A: Mannitol salt agar (MSA) is both a selective and differential media used for the isolation…
Q: You have retrieved your MHA (Mueller-Hinton agar) plate, your materials, and your E. coli culture.…
A: Answer : First step of the kirby-Bauer test :-
Q: biochemical tests only. Solve the identity of an unknown bacterial specimen by creating a…
A:
Q: Which of the following methods is most sensitive for identifyingdifferent strains of a microbe?a.…
A: Microorganisms or microbes are small living organisms that can be observed with the aid of…
Q: What can you conclude about the Gram stained specimen? View the image in greater detail. Based on…
A: Introduction Gram staining, commonly known as Gram's method, is a staining technique that is used to…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- topic: bacteria - please do not just copy from google 2. what cell parts are visible on the bacteria?I BIO-103-LAB-WORKSHEET-3_BACTERIAL_MORPHOLOGY.docx - Trio Office Writer File Edit View Insert Format Styles Table Form Tools Window Help Abç # a a a ab ah & a 三、三军三E Default Style Calibri 12 I 1 I II Guide Questions: Illustrate the different forms of bacteria. 1) Spherical - coccus diplococcus streptococcus staphylococcus mono coccus 2) Rod-shaped bacillus club-shaped bacilli rodswith square ends fusiform bacilli rods with rounded ends 3) Curved rod - spir illa a. rigid form Spirillum vibrio Page 2 of 3 143 words, 1,416 characters Default Style English (USA) + 80% 8:26 AM P Type here to search 13 15 2/6/2021Identify the Eukaryotic Microogranisms in the worksheet, accordingly. I'm having difficulty separating them. Please help!
- + courses/_518299_1/cl/outline?customClassicLocation=%2Fwebapps%2FBb-McGraw Hill-BB5744b9beb8ccb%2Fapp%2Flink%2Finbou.... File Edit Format Tools Help Qa 11 Chapter 2 ● Exam 2 Review Sheet ● Normal ● ● ● Unsaved Chantor 7 Edits will not be automatically saved. Calibri T Save now 14 ▾ BIU A A- EEEE VE What are the important characteristics of atoms and elements? What are the different types of chemical bonds? What are the various types of chemical reactions and solutions? What determines acidity and alkalinity, and how do they relate to the pH scale? What makes carbon the fundamental element of life? What are the four types of biological macromolecules, and what are their general structures and functions?Copy and paste the link below and watch the video on Youtube https://www.youtube.com/watch?v=8RBs0Ghg_48 Answer the following Questions: 1. What are the chemicals and materials used in gel electrophoresis? 2. Draw a schematic diagram of a gel electrophoresis set-up 3. Describe the procedure in doing a gel electrophoresis experiment. Why is there a need for a leveling bubble/leveler? What is the use of the rubber dam? 4. What is the use of ethidium bromide and why must you wear gloves when you handle it? 5. What makes the DNA fragment move towards the positive plate? 6. What is the purpose of glycerol in the sample buffer? 7. What is the use of a DNA ladder? 8. What will happen when you increase the voltage of the set-up? 9. Can gel electrophoresis be used to separate amino acids? If so, how is it done?les/test/tq.php?testid=2804&strandid%3D&element%3D&difficulty=assessment&assignment_id%3D45196931&load_test%-D1&teacherPr B Brainly.com-For st.. O Instagram N Netflix a Escape Room (Und. USATestprep, LLC - E Google Docs Stu wrerhd.cells at rer rote due to the siiple diffsion of Save C) 01ann suan an sianua LUPInaPLiaipaih ep snan aun aAPa IM JaPAA active transport. Glucose molecules will move from the cells into the solution in the beaker D) through facilitated diffusion. When examining the major macromolecules in the cell, a student isolates two molecule types that are directly responsible for cellular energy. A comparison of which molecule types will be most likely to include the molecules primarily responsible for cellular energy? A) proteins and lipids B) carbohydrates and lipids proteins and carbohydrates D) carbohydrates and nucleic acids Proteins and polysaccharides are polymers. These polymers are formed by dehydration synthesis. Which statement correctly identifies a…
- https://www.youtube.com/watch?time_continue=2&v=B_lHQSxz9GI&feature=emb_logo Using what you’ve learned from the video, answer the following questions in the spaces provided.1 Death is a major event not only for the person who dies but also for the microbes that inhabit their body. Which of the following statements best describes why? a. All the microbes that were living inside the person’s body die when the person dies. b. Microbial populations grow and spread to different areas of the body after the person dies. c. Microbes in the body have fewer resources after the person dies, which increases competition. 2 Which of the following statements about cadavers (dead bodies) is most likely to be true? a. Microbial communities in and around a cadaver change over time. b. Samples taken from different cadavers always contain the same microbes. c. The microbial community found in a cadaver is very similar to the one found in a living body. 3 After death, gases build up inside the…G Search results - Ifortun1@email.essex.edu - Esse cmiguel@gmail.com-Gmail Open with Google Docs C. D Figure 9.2 Using Figure 9.2, match the following: 42) I band. 42) 43) H zone. 43) 44) A band. 44) 45) Z disc. 45) 46) M line. 46) Page 8 | 8 +write out a detailed summary on E.Coli. Questions below will help yu frame your summary. Please describe the bacterium. What is its shape and size? Is it Gram-positive or negative? Pictures are always fun! If you can find a microscopic image – include it. What is/are the reservoir(s)? e.g. water, food, human, etc. Are there parameters needed for infection? (Temperature, pH) What is/are the mode(s) of transmission. If it's foodborne - is it linked to a specific food? How many cases occur each year? In the US and/or worldwide and/or in the County where you live Has it caused any outbreaks or epidemics? Thank you-
- A elearn.squ.edu.om/mod/quiz/attempt.php?attempt3D13353288&lcmid%3D6971498&page31 ming System (Academic) -23 A scientist is interested in a genetically modified fungus that has a restricted reproduction mechanism in order not to reproduce in the laboratory. To prevent fungal replication, which mechanism should be disrupted? put of Select one: O a. Spore formation uestion O b. Symbiotic relationship with others O c. Nutrient absorption O d. Mycelium formation O e. Septa formation 4 In the formation of the polynucleotide chain, one nucleotide is connected to ... Select one: of O a. The sugar and nitrogenous base O b. The phosphate group and the sugar tion O c. The nitrogenous base and sugar O d. The phosphate group and the nitrogenous base O e. The sense and anti-sense strandsThe sequence shown in Figure 2 is the nucleotide sequence of a heat shock protein of Bacillus anthracis obtained from the NCBI database. >NC_005945.1:2107825-2108262 Bacillus anthracis str. Sterne chromosome ATGCGTAATTTATTTCCAGAAATAACAAAACGTCAAAATGGTATTTTTGATTTTGGACCTTCTTTATTAG AAGGGATGACAGATGCTTTCTTTAAACCGATGAACATGGATATTTTTAAAGTAGATGTTCATGAACAATC TGATAAATATACAGTGAAAGCAGATTTACCAGGTTTTCAAAAAGAAAACATTCAAGTTGAATTTGAACAA GATGTATTAACGATTCAAGCAACTAATCATAATGAAGTAGAAGAAAAAAATGAGAATGGCACATATATTC GTAAAGAACGTTCTATAGGTTCTGTAACTCGACGTTTTAGTTTTAAACAAGTTGAGGAAGAAAATGTTAG AGCGAATTACAAAGATGGCGTGTTGACAATTGAATTGCCAAAATTGAAAGAAGAAAAAAACAGTAAAACA ACAATTAATATTGAATAA Figure 2 (i) Is the nucleotide sequence above translatable into a complete protein? Justify your answer. (ii) Is the sequence above represented in the standard FASTA format? Explain your answer.The sequence shown below is an actual sequence of the toxin gene from Salmonella enterica subspecies serovar Typhimurium strain obtained from the NCBI database. ATGCGAACCTTCAAAACCAGGTGGTTTAACAGAGAAGCGAAGCCCCACACGATAAAAGATGACGAGTTAA GCGAGGCCATCAACGCCGTACTGCAAGGAAAAGCAGATAATCTTGGCGGCGGGGTTTATAAAAAACGTCT CAATCAAAATCGCGATCGCGCAATCGTGTTGGCAAAGGGAGGCGAACATTGGTTTTACACCTTCCTGTAT GCCAAACAGGATATGGCCAACATTAGCTATCGCGAACTCGCGGGTTTCCGTGAGTTAGCAAAACACTATG CTTGCCTGACCGAAGATCAGATAACGGCACTCATTAATAACAAAGAACTGGTAGAGGTGCGCCATGTCAG CAAAAACTAA (i) Is the nucleotide sequence above translatable into a complete protein? Give justification. (ii) Is the sequence above represented in the standard FASTA format? Explain your answer. (iii) Liliana, a research officer would like to perform a multiple sequence alignment between the sequence above with eight other toxin genes sequences obtained from other researchers. Define multiple sequence alignment. (iv) Which multiple sequence alignment program would you recommend…