Tapje Zea mays stem, x.s. 2. The Herbaceous Dicot Stem Label the parts in the different representative species of herbaceous dicots: Epidermis Cortex Vascular bundle Phloem Bundle cap/fibers Vascular cambium Collenchymatous tissue Pith Xylem Pith rays Nature Picture Library Aristolochia young stem, x.s.
Q: Cells go to great length to correctmistakes in the processes of DNAreplication, transcription,…
A: When Errors in Replication Become Mutations After the next cell division, incorrectly coupled…
Q: hair, underdeveloped nails, and abnormally shaped eyelids. In the following pedigree, which…
A:
Q: Which of the following is NOT a connective tissue? A. blood B. mesothelium С. fat D. tendon
A: Introduction - Tissue that backings, secures, and gives design to different tissues and organs in…
Q: part i How many of the following are characteristics of arthropods? 1. protostome development…
A: Characteristics of arthropods (Correct options): Option 2: Arthropods are bilaterally symmetrical.…
Q: furbaby scratches your friend. Her skin is reddened and feels warm and sore to the touch;
A: Connective tissue: The collection of cells combines to form a tissue. Tissue combines to form organs…
Q: Compare and contrast gel-electrophoresis for the separation of nucleic acids and SDS-PAGE for the…
A: In-gel electrophoresis, DNA, RNA, and proteins are separated based on the charge and mass. nucleic…
Q: Provide one example of each microtechnology and nanotechnology in healthcare, especially ones that…
A: Microtechnology includes techniques that makes use of processes and objects at a micro level. The…
Q: 1 mL of a juice sample is taken and diluted in 9 mL culture medium, subsequently, this suspension is…
A: Petroff- Hausser chamber is a chamber used usually for sperm and bacterial count. Number of bacteria…
Q: Which virus has a genome that can be directly translated in the host cytoplasm after entry??…
A: Viruses have diversity in terms of the structure, the method of replication, and host and target…
Q: .How much PCR product (500 bp) should be added to a ligation in which 50 ng of Vector (6.6 kb)…
A: Introduction :- Polymerase chain reaction (PCR) is a widely used method for rapidly producing…
Q: The risks and benefits of the use of genetically modified organisms (GMOs) is a topic of each…
A: Answer : the following is NOT a risk or benefit of GMOs is : D. Dominant competition and promote…
Q: 11. The scales of pine cones are (a) always green. (b) modified roots. (c) modified leaves. (d)…
A:
Q: Explain the typical immunophenotypic features of peripheral B cells in: (i) X-linked…
A: X-linked agammaglobulinemia also called XLA - is an inherited (genetic) immune system disorder that…
Q: The bony wall found at the end of the middle ear has O the three ossicles: malleus, incus and stapes…
A: As per our honor code, we are allowed to answer one question at a time. You have posted multiple…
Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…
A: The process of protein synthesis involves two major steps - Transcription Translation During…
Q: 2.If you were running an experiment and interrupted the interaction between thin and thick…
A: Introduction :- When a sarcomere (a) contracts, the Z lines become closer together and the I band…
Q: Exactly what is the purpose of genetic foresight, and why is it necessary?
A: Genetics can be considered the study of genes as well as heredity. It focuses on how specific…
Q: For the hierarchy of skeletal muscle organization, which accurately lists the order of structures…
A: The smallest functional unit of skeletal muscle organization is sarcomere. It is a highly organized…
Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…
A: Conversation of non functional mRNA to functional mRNA is done in many steps.. 1. A…
Q: indicate if TRUE or FALSE 1. Cactus is an inhibitory protein.
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: providing at least TWO specific examples of advances that took place in the last 150 years that…
A: Life expectancy is the average life span or the average years a person can live. On an average,…
Q: Different hypersensitive responses can result from a bee sting. What type of hypersensitivity could…
A: i) This case is of hypersensitivity type 1 as the effect disappears within an hour and does not get…
Q: The mineral ion needed for the formation of blood clot is : (A) Potassium (B) Sodfrym (C) Calcium…
A: Introduction :- A blood clot can be caused by anything that prevents your blood from flowing or…
Q: Q5. Based on the data in the table below, which of the following most likely correctly identifies…
A: Nutrients are required for the proper growth and development of the organism. Some nutrients are…
Q: X Observe: Click Next. What happens in the cytoplasm? This process is called glycolysis. Two…
A: Glycolysis is a metabolic pathway. It breaks down glucose into two three carbon compounds called…
Q: While blood type incompatibility is rarely a problem during pregnancy, Rh incompatibility can be. Rh…
A: i) Rh incompatibility occurs only if the mother is Rh- and the child is Rh+ because mothers Rh-…
Q: A ВЕ 1. saturation of blood and tissues with dissolved gases 2. decompression B. Oxygen starvation…
A: Option C
Q: Which of the following is NOT a stock form of the key molecules for energy generation in muscle? A.…
A: Adenosine triphosphate (ATP) is used to generate energy in muscles. A significant amount of ATP is…
Q: THE FACTOR THAT DOES NOT AFFECT THE MICROCLIMATE 1. Illumination 2. air temperature 3. air humidity…
A: Microclimate means the climate of a small specific place within an area as compared to climate of…
Q: In addition to observing similarities to the lac operon, you also notice that this gene is regulated…
A: Transcriptional attenuation negatively regulates the expression of many operons in bacteria by…
Q: Explain why the 16S rRNA gene sequence can reveal useful information about bacterial taxonomy that…
A: Introduction :- The majority of bacteria are not harmful. Those that are have specific virulence…
Q: Sometimes slides of a coal miner's lung and of lung cancer are available. Either use slides or the…
A: INTRODUCTION Cancer is a sickness in which a number of the frame’s cells grow uncontrollably and…
Q: Draw an egg. Show and describe the following poles. Animal pole Vegetal pole
A: Egg is the female gamete. It is the largest single cell. Have plasma membrane. It provides…
Q: . Describe which enzymes are required for lactose and tryptophan metabolism in bacteria when lactose…
A: ANS 1.The enzymes of the lactose operon are needed to break down and use lactose as an energy…
Q: How can countries in the Caribbean produce wine
A: Making wines from tropical fruit involves the same factors as making wine from fruit that is native…
Q: The variation seen in newborn birth weight is an example of a continuous quantitative trait. O A)…
A:
Q: Other than obvious changes in protein-encoding Neanderthal genes, changes in what type of non-coding…
A: Small tandem repeats (STRs) are short repeating DNA sequences (2–6 bp) that contribute for about 3%…
Q: 1. ionosphere 2. lithosphere 3. troposphere 4. magnetosphere 5. stratosphere
A: The atmosphere is divided into many layers depending upon the availability of air, intensity of…
Q: What are the three elements of a sustainable process ofrecycling?
A: Introduction :- The process of converting waste materials into new materials and objects is known as…
Q: i. Name the function for the white band of tissue at arrow A. ii. Name the space at arrow B. iii.…
A:
Q: All of these characteristics of P. aethiopicus suggest that it may represent an evolutionary…
A: Paranathropus is derived from a greek work, in which "para" means near and "anthropus" means man,…
Q: SECONDARY PREVENTION BTOРИЧНАЯ ПРОФИЛАКТИКА 1. early diagnosis of diseases, the adoption of the…
A: Secondary prevention is one of the preventive measure which aims to mitigate the impact of a…
Q: The role of the ossicles is to of vibrations Decrease the intensity Increase the strenght O Change…
A: Introduction :- The auditory ossicles are three bones in each middle ear that work together to…
Q: UV RAYS (RANGE FROM 275 TO 180 NM) - AN EFFECT ON THE BODY 1. normalization of phosphorus-calcium…
A: Introduction :- UVC, which measures 200 to 280 nm, has the shortest and weakest wavelength. It has a…
Q: e/1FAlpQLSfcb08kSEoX2nkHlw2TQntW-IHbohTvMGsXQmKO36VumnFnEQ/formResponse Displacement of the hair…
A: Sensory neurons transport information from sensory receptors to the central nervous system (CNS),…
Q: Using a viral capsid as a delivery mechanism of a compound is a part of which technology? protein…
A: Please follow step 2 for detailed explanation.
Q: Contrast positive versus negative regulation of gene expression. Describe the role of the repressor…
A: Positive and negative control of gene expression In some cases, the product of a regulatory gene is…
Q: Transcription is the first step in gene expression. It involves copying a gene's DNA sequence to…
A: Rho factor works by binding to the transcript and halts transcription by actually breaking hydrogen…
Q: 1. in the presence of fences and objects having a lower surface temperature than the temperature of…
A: When a fluid, like air or liquid, is warmed and subsequently moves away from the origin, the thermal…
Q: 2. What is the main difference between the following organisms: strep, aids, polio, measles, and…
A: INTRODUCTION Virus This is the small microscopic infectious agent which can multiply only inside a…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 4 images
- The image above shows a cross-section through a portion of the root of Phalaenopsis sp. stained with Toluidine Blue pH 4.4. Select the correct match to identify the items indicated. phloem tissue 1. 1 endodermis 2. 2 pericycle 3. 3 sieve tube 4. 4 passage cell 5. 5 6 6 xylem vessel 7. 7 xylem tissue 8. 8 companion cellLabel the following parts of a Zea mays (corn): Epidermis Ground tissue Хylem Phloem Bundle sheath Bundle cap Vascular bundle by Dreamstime.com FOTOSTOCK Zea mays stem, x.s.A few layers of thick walled parenchymatous cells, which lie below the endodermis in dicot root is called Conjuctive tissue Pericycle Casparian strips Hypodermis
- DICOT ROOT MONOCOT ROOT Vascular Tissue shape Pith OtherThe epidermis___________. Is made of lignified cells that created a protective layer over the surface of a plant Expands throughout secondary growth Generates all trichomes Prevents gas and water exchange with the environmentLabel the following structure/s: (Figure 2) Potato tuber cells with starch grains, label the parenchyma cells.
- Which of the following is not a term used in reference to flowers? corolla sepals O calyx O perianth androecium gynoecium mycorrhizae stamenMesophytic leaf cross section and label the cuticle, upper and lower epidermis, palisade mesophyll, spongy mesophyll, veins, intercellular spaces, stomata, and the bundle sheath. Label the words in bold of the Mesophytic leaf crossection eudicot!Below is a series of pictures of a leaf (x.s.) from a eudicot, Syringa vulgaris. 40x (x.s.) Make a sketch of the 40x leaf cross section and upload it here with the following structures labeled: upper epidermis, cuticle, stomata, guard cells, mesophyll (palisade and spongy), veins (xylem and phloem), bundle sheath, collenchyma cells, lower epidermis MacBook Pro
- ON Section: PLANT PRIMARY GROWTH AND DEVELOPMENT Review the image of the Coleus stem tip, longitudinal section, in Exercise 4.2. then answer the questions below: Describe the changes in cell size and structure in the stem tip. Begin with the youngest cells at the apex (tip) and continue to the xylem cells.It refers to roots that originate in stems and leaves The part of the orchid root epidermis that functions for gas exchange when the root is saturated with moisture._Below is a series of pictures of the stem (x.s.) of a sunflower, Helianthus sp. Note that it shows both a young stem and older stem. E- young 100x (x.s.) older 100x (x.s.) Make a sketch of both ages and upload it here with the following structures labeled: epidermis, cortex, pith, vascular bundles, fibers, primary xylem, primary phloem, tracheids, vessel elements, collenchyma