AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGAGGCCACCGCUGAAGAAGCCUGGACCUAGCCUCCGAAUUGAAGCUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAGCCUCCGAUCCUGGACCUAG MetValHisLeuThrProGluGluLysSerAlaValTrpGlyLysValAsnAspGluValGlyGluAlaGlyArgLeuLeuValTyrProTrpThrGlnArgPheGluSerPheGlyAspLeuSerThrAspAlaMetGlyAsnProLysValAlaHisGlyLysValLeuGlyAlaPheSerAspGlyLeuHisAspAsnLeuLysGlyThrPheAlaThrSerGluLeuHisCysAspLysLeuHisValAspProGluAsnPheArgLeuGlyAsnValLeuValAlaHisHisPheGlyLysGluPheThrProValGlnAlaAlaTyrGlnValValAlaGlyValAlaAsnAlaHisLysTyrHis MetValHisLeuThrProGluGluLysSerAlaValTrpGlyLysValAsnAspGluValGlyGluAlaGlyArgLeuLeuValTyrProTrpThrGlnArgPheGluSerPheGlyAspLeuSerThrAspAlaMetGlyAsnProLysValAlaHisGlyLysValLeuGlyAlaPheSerAspGlyLeuHisAspAsnLeuLysGlyThrPheAlaThrSerGluLeuHisCysAspLysLeuHisValAspProGluAsnPheArgLeuGlyAsnValLeuValAlaHisHisPheGlyLysGluPheThrProValGlnAlaAlaTyrGlnValValAlaGlyValAlaAsnAlaHisLysTyrHis I have amino acids listed and mRNA but do not show the DNA sequence can you help me to figure out?

Q: What is the role of regulatory gene mutations in cancer?

A: Regulatory genes are defined as genes which control or regulate the expression of one or multiple…

Q: Why was sequencing the human genome such a formidable task?

A: Human Genome Project is a project which tells about the DNA sequence of the complete human genome.…

Q: Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA:…

A: 1. DNA- GTATACCAGTCATTTGTC mRNA- CAU AUG GUC AGU AAA CAG Amino acids - His- Met-Val-Ser-Lys-Gln

Q: Learning Outcomes: 1. Prepare IM injection correctly recalling 5 rights of medication. 2. Develop a…

A: Introduction Nasogastric intubation is a medical procedure in which a plastic tube is inserted via…

Q: A study in a British medical journal found there was a correlation in telomere length between…

A: Telomeres are the repetitive set of nucleotides sequences and protein complex present at the end…

Q: Select the statement that apply to the bottleneck effect: 5 correct answers

A: In a population bottleneck, the residual population is subjected to increased genetic drift, which…

Q: 6) The functioning of the "Ras/MAPK" signal transduction pathway is absolutely essential in order…

A: Targeted therapy is a type of cancer treatment that targets proteins that control how cancer cells…

Q: The MC1R gene affects skin and hair color in humans.There are at least 13 polymorphisms of the gene…

A: A gene is the essential physical and functional unit of heredity. Genes are comprised of DNA. A…

Q: Cyanobacteria are photosynthetic prokaryotes that are likely responsible for generating the gen-rich…

A: Answer ::   An alternative pathway for glucose oxidation is the pentose phosphate pathway (PPP). In…

Q: Give 4 causes of crystal formation in a synovial fluid.   V. Name the tests and storage of the 3…

A: Synovial fluid, also known as joint fluid, is a thick liquid located between your joints.

Q: Biology why do plants closer to water have a larger xylem diameter and higher hydraulic…

A: Climate, water supply, weather patterns, soil nutrients and soil characteristics, availability of…

Q: Discuss the following statement: “from the nucleotide sequence of a cDNA clone, the complete amino…

A: The proteins are the polymer of amino acids. They play an important role in the cell, by catalyzing…

Q: Extravasation has two phases: margination and diapedesis. Describe what happens during these phases…

A: Extravasation- The leakage of blood, lymph, or other fluid from a blood vessel into the tissue…

Q: Compare the jawed fish to the amphibian. Relate one way they are alike and 2 ways they are…

A: Introduction Vertebrates:- are also called Craniata, any animal of the subphylum Vertebrata, These…

Q: QUESTION 4 Target cel receptors can be activated or inhibited by specific hormones O True O False…

A: Hormones attach to receptors on target cells, causing biological changes. In reaction to hormone…

Q: 1. From an evolutionary standpoint, why is sexual reproduction considered an advantage over asexual…

A: Over successive generations, evolution is defined as a change in the heritable traits of biological…

Q: Birds are sometimes called avian reptiles. Discuss why this description is appropriate

A: Birds are a type of warm-blooded animals defined by feathers, toothless beaked jaws, hard-shelled…

Q: If a quantitative trait follows a continuum, this means that:

A: A phenotype that can be measured is referred to as a quantitative trait. Genes, environment, or the…

Q: Give the protein synthesized of the given mRNA sequence. No need to explain. Just give the answer.…

A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: Cadmium ions have been shown to be selective blockers of membrane calcium channels. Suppose T…

A: Cells communicate with each other via released proteins unique to each kind. Signal transduction…

Q: 6. In molluscs.the umbones are other. when they face each a. prosogyroUs b. opisthogyrous c.…

A: Mollusca is the second largest invertebrate animal phylum after Arthropoda, and its members are…

Q: Give the common name of the following: answer 1,2,3,4,5,6,7,8,9,10. 1. Fasciola gigantica 2.…

A: A name of any type of species which is generally used by people and is not common for every person…

Q: Hello! dicuss the adaptations of Grapevine downy mildew to invade and manipulate their hosts.…

A: INTRODUCTION Downy mildew is a dangerous fungal disease that can cause significant crop loss in…

Q: Apply the Key terms to fill in the blanks to demonstrate knowledge of cancer development. Key terms:…

A: 1. Regulator  2. Mutated 3.cell cycle 4.unrepaired 5. Check points.

Q: 13.21 Explain the key difference in the biology of Batillaria and Cerithidea that indicates the…

A: An organism's "niche" is defined by the collection of circumstances, supplies, and relationships…

Q: Do the bottom diagram Find all th calculations Micrograph width is 0.2mm at 400x Draw a micrograph…

A: at 1000x magnification = 1.78mm x 100 divided by 1000 = 0.178 mm or 178 micrometers. Stage…

Q: List the different lethal toxins and their mechanism.

A: Answer

Q: Describe and differentiate the thorax of the ox from that of the thorax of the horse and the pig.…

A: Thorax is described as the region that lies between the neck in a superior manner and the abdomen…

Q: Webbed fingers is inherited as an X-linked disease An unaffected male marries an affected female. a.…

A: Let,  XF - non webbed X linked allele Xf - webbed X linked allele Genotype of the unaffected male -…

Q: Wound healing and mitotic rates in the damaged cornea of a mouse. The level of DNA replication in…

A: Introduction Mitosis is the division of replicated chromosomes into two new nuclei during the cell…

Q: Using flow diagrams show the main steps in antigen and antibody detection ELISA's.

A:

Q: 1. If an inherited traits displays variation in a population, then the trait is considered: 2. A…

A: Introduction Genetics:- It is the study of genes and tries to explain what they are and how they…

Q: What is a possible dichotomous key that can be formed from the following species: Synapta…

A: Synapta- echinoderms Balanus-  Arthropods Mellanoides- mollusca Squalus- chordata Tachypleus-…

Q: Identify the parts and the function of each parts of Pyrococcus furiosus and Salmonella typhimurium.…

A: Prokaryotes include Archaea and Bacteria, which are two different types of microorganisms. Archaea:…

Q: Which of the following is NOT regulated by glucagon? Glut-4 transporters O protein kinase A O…

A: Methylation is a posttranslational alteration of proteins that modulates the function of several…

Q: Question 1 We have received a specialized blood sera that contains antibodies. We want to test…

A: Antibodies are proteins in the form of molecules. Proteins are biomolecules made up of several…

Q: List distinguishing characteristics, describe a typical life cycle, and give examples of each of the…

A: Fungus (plural fungi) are any of the around 145,000 known species of fungi, including includes…

Q: 6.3.7 Activit (1) List and briefly explain four methods of studying an E-S complex. (2) (a) Which…

A: Amino Acids are organic compounds that combine to produce proteins, which is why they are known as…

Q: As you likely know, the lysosome is filled with hydrolyzing enzymes. As a result, the environment…

A: The lysosome in the cell is a membrane bound organelle, that contains a wide range of hydrolytic…

Q: How is ELISA used to detect Ebola (what antigens or antibodies)? How is this procedure done?

A: ELISA means enzyme-linked immunoassay. ELISA works on the antigen antibodies binding principle  in…

Q: Question 2 Cutting DNA into various size fragments is part of... Genetic fingerprinting Genetic…

A: Answer

Q: some of the above choices are strict aerobes and some are facultative anaerobes. This is helpful to…

A: Aerobic organisms Aerobic bacteria are organisms that can grow only in the presence of oxygen.…

Q: How does oviposition occurs in female frugs. Provide the pathway involved in the oviposition process

A: The female reproductive system consists of ovaries and oviducts. A pair of ovaries located near the…

Q: reproductive

A: Turtle- It is an reptile belongs to order Testudines. these are mainly characterized by a shell…

Q: Select all the intermediates that would be isolated if the enzyme malate dehydrogenase was inhibited

A: isocitarte succinate malate a-ketoglutarate fumarate  citrate succinyl coA

Q: ssium important to the sodium pump? Potassium a) maintains water concentration O b) binds with the…

A: Potassiun pump This pump is found in cell membrane. ATP is needed for this pump to move Na+ and K+…

Q: Why is tooth structure important in the study of mammals

A: Mammals are heterodont, that implies they have a variety of teeth that serve specialised or distinct…

Q: b. As we have learned, the HbA1C glycosylation event occurs non-enzymatically in the body. HBA1C…

A: HbA-HbA is the most common type of hemoglobin which is present in red blood cells It is also known…

Q: List the four most common elements in organic molecules and state which common macromolecules always…

A: Introduction  Biomolecules such as carbohydrates, lipids, proteins, nucleic acid, etc. are very…

Q: An increase in the reabsorption of solutes will decrease water reabsorption. True False

A: ANSWER;- True

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.