Suppose a researcher previously cloned gene Y into M13 bacteriophage vector. Gene Y encodes a product called peptide Y. Aregion of gene Y contains the DNA sequence ATG-CGC-GAA-CTG-GTG-AAC-TAA. The researcher wishes to change a Valresidue to an Ala residue in this region of peptide Y using site-directed mutagenesis.What should be the sequence of the mutant oligonucleotide primer in this region? You may use a codon table.mutant oligonucleotide primer sequence:GGC-GGC-GAA-CTG-GTG-AAC-TAAIncorrect

In order to solve this problem, first we need to find the amino acid sequence of the wild (original)…

Answered: Suppose a researcher previously cloned…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

The enzyme dihydrofolate oxidase has 3 adjacent asparagines residues (codon for asparagines is ACC): explain how site directed mutagenesis could be used to increase the thermal stability of the protein
You are interested in studying resistance to heavy metals and have selected the yeast Saccharomyces cerevisea to conduct your studies. You have recovered a deletion mutant that does not tolerate high concentrations of zinc (grows poorly in zinc containing media ) and have designated the mutant pgz-1 (for poor growth in zinc ). (a) What is the advantage to the type of mutant used in this work? What class of mutagen was likely use to generate pgz-1? ( b) Do you expect the PGZ gene to be expressed in your mutant? Explain.
Although a large number of mutagenic chemicals are known,none is known that induces mutations in only a single gene(gene-specific mutagenesis). From what you know aboutmutagens, explain why it is unlikely that a gene-specificchemical mutagen will be found. How then is site-specificmutagenesis accomplished?
Suppose you have six strains of E. coli. One is wildtype, and each of the other five has a single one of thefollowing mutations: lacZ−, lacY−, lacI−, oc, andlacIS. For each of these six strains, describe thephenotype you would observe using the following assays. [Notes: (1) IPTG is a colorless synthetic molecule that acts as an inducer of lac operon expressionbut cannot serve as a carbon source for bacterialgrowth because it cannot be cleaved byβ-galactosidase; (2) X-gal cannot serve as a carbonsource for growth; (3) E. coli requires active lactosepermease (the product of lacY) to allow lactose,X-gal, or IPTG into the cells.] Colony color in medium containing glycerol as theonly carbon source and X-gal, but no IPTG.d. Colony color in medium containing high levels ofglucose as the only carbon source, X-gal, andIPTG.e. Colony color in medium containing high levels ofglucose as the only carbon source and X-gal, butno IPTG
The streptolysin S toxin made by S. pyogenes is encoded by a 9-gene operon, sagABCDEFGHI. Thinking about what a 3-line diagram would look like for this operon, answer the following questions. Write numeric answers only. For example, if your answer is 6 promoters, write only 6. 1) How many promoters control the expression of these genes? 2) How many locations does RNA Polymerase bind to get full expression of these genes? 3) How many ribosome binding sites are needed for full protein expression? 4) How many start codons will be needed for full protein expression? 5) How many mRNA strands will be produced with full operon expression? 6) How many proteins will be produced with full protein expression? 1
Termicin is a small antifungal protein in termites that is produced by cells and secreted into termite saliva in response to a pathogen. In vitro translation of the termicin-encoding gene is performed, and the effects of that product are compared to those of termicin extracted from a termite. You see that extracted termicin exhibits more antifungal behavior than in vitro translated termicin. After further analysis, you see that extracted termicin contains 3 disulfide bonds, while in vitro translated termicin contains zero. The addition of microsomes to the in vitro translation reaction results in termicin with all 3 disulfide bonds. What experimental condition is most likely responsible for this difference? A. in vitro translation was not performed at the correct temperature affecting protein folding B. a mutation occurred during in vitro translation, leading to differences in disulfide bond formation O C. the UPR can not be activated in vitro, therefore, this protein can only be…
Eukaryotes modify mRNA with an m7G cap: an N7-methylated guanosine linked via a 5′ to 5′ triphosphate linkage, and by methylation at the 2'-hydroxyl of the penultimate nucleoside. Provide a summary of the chemical steps and cofactors involved in the capping reaction.
Negative supercoiling of DNA favors the transcription of genes because it facilitates unwinding. However, not all promoter sites are stimulated by negative supercoiling. The promoter site for topoisomerase II itself is a noteworthy exception. Negative supercoiling decreases the rate of transcription of this gene. Propose a possible mechanism for this effect and suggest a reason why it may occur.
Mutagenesis is a technique in which genetic information of an organism is altered in a stable manner resulting in a mutation. It may occur spontaneously in nature of as a result of exposure to mutagens. It can also be achieved experimentally using optimized laboratory procedures. (i) (ii) What is site directed mutagenesis (SDM)? Explain how SDM can assist in the integration of a His-tag at the end of your gene of interest.
A number of mutations affect the expression of the lac operon in E. coli. The genotypes of several E. coli strains are shown below. ("+" indicates a wild-type gene with normal function and "-" indicates a loss-of-function allele.) Please predict which of the following strains would have the lowest beta-galactosidase enzyme activity, when grown in the lactose medium. Orpt o* z* r* Orpt ot z* Y OrptoztY Orrotzr OrPotz*Y
Below is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?
Eukaryotes modify mRNA with an m7G cap: an N7-methylated guanosine linked via a 5′ to 5′ triphosphate linkage, and by methylation at the 2'-hydroxyl of the penultimate nucleoside. What cofactors involved in the capping reaction

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS