Inducer (lactose) Inducer (lactose) absent present B- B- Genotype Permease Permease Galactosidase Galactosidase lacI* lacP* a. laco* lacZ* lacY lacI* lacP* b. lacO lacz* lacY lacI lacP* c. lacO lacz+ lacY lacI lacP* laco* lacZ* lacY*/ d. lacI* lacP laco* lacz* lacY lacI lacP* lacO lacz e. lacY /lacI* lacP* lacO* lacz* lacY* lacI* lacP lacO lacz* f. lacY /lacl lacP* laco* lacZ lacY

Inducer (lactose) Inducer (lactose) absent present B- B- Genotype Permease Permease Galactosidase Galactosidase lacI* lacP* a. laco* lacZ* lacY lacI* lacP* b. lacO lacz* lacY lacI lacP* c. lacO lacz+ lacY lacI lacP* laco* lacZ* lacY/ d. lacI lacP laco* lacz* lacY lacI lacP* lacO lacz e. lacY /lacI* lacP* lacO* lacz* lacY* lacI* lacP lacO lacz* f. lacY /lacl lacP* laco* lacZ lacY

Name: A strain of E. coli has the genotypes shown below at the lac operon, w
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: A strain of E. coli has the genotypes shown below at the lac operon, where I = regulator gene, P = promoter, O = operator, Z = βgalactosidase gene, and Y = permease gene. The superscript+ indicates a wild-type allele,c indicates a constitutive mutati

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

help. 1. To produce a specialized-transducing mycobacteriophage construct, a cosmid bearing the allelic exchange substrate is electroporated in Mycobacterium smegmatis, followed by an incubation at 30°C. True/ False 2. A recombineering system involves the over-expression of recombinase proteins, which allows the use of a short DNA fragment as allelic exchange substrate, but can also be combined with the use of a mycobacteriophage construct. True/ False
Interrupted mating experiment between Hfr and F strains can be used to map the bacterial genes. In the following experiment, an Hfr strain X (azi' gal" gly" his lac leu' thi" thr' str' ton') was mixed with the F strain which is auxotrophic for threonine (thr'), leucine (leu'), glycine (gly), and histidine (his'), is resistant to streptomycin (str), but is sensitive to sodium azide (azi"), and to infection by bacteriophage TI (ton'), and is unable to ferment lactose (lac') or galactose (gal). At various time intervals, small aliquots were removed and mixed violently to separate the conjugating cells. The samples were then plated onto selective media to measure the frequency of thr' leu' str recombinants. It was learnt that thr and leu were very close to the origin of replication and str was quite distant from the origin of replication in the Hfr chromosomal DNA. The results obtained are illustrated in the figure below. azi ton lac gal his gly 5 10 15 20 25 30 35 Time of conjugation…
GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
21:14 +4G KB/S LTED 41 96 09.00 Vo Microsoft Word - Assignment 02.docx Assignment 02 1. Groups of alleles associated with the lactose operon are as follows (in order of dominance for each allelic series): repressor, IS (superrepressor), I *(inducible), and I "(constitutive); operator, OC (constitutive, cis dominant) and 0+ (inducible, cis- dominant); structural, Z and Y. (a) Which of the following genotypes will produce B-galactosidase and B-galactoside permease if lactose is present: (1) 1*0* Z* Y*, (2) 1 *OCZ+ Y+, (3) OCZ+ Y+, (4) IS O+ Z+ Y+, and (5) 10+ Z+Y+? (b) Which of the above genotypes will produce ß-galactosidase and ß-galactoside permease if lactose is absent? Why? 2. By what mechanism does the presence of tryptophan in the medium in which E. coli cells are growing result in premature termination or attenuation of transcription of the trp operon? 3. Suppose that you used site-specific mutagenesis to modify the trpL sequence such that the two UGG Trp codons at positions…
Eight mutant bacteriophage strains cannot lyse a certain type of bacteria that can be lysed by wild-type bacteriaphages. The mutant strains were allawed to infect the bacteria in a complementation test. A "+ indicates that lysis occurred with coinfection.Aindicates that lysis did not occur. GKWTMAQC G -++|+ ++l+ - K. - + - ++ +| + -+| - |-++ + + + M - + + + A cistron is defined by no complementation in the Ciş : configuration. Haw many genes are controlling lysis in this bacteriophage? (Use a number not a word in the space) 3 Which of the following strains below are defective in the same gene as strain Q? Answer yes if the strain is defective or no if it is not. Strain Defective A N/A
LS1-1 Which of the following best represents the amino acid sequence found in normal adults with the HBB gene? O His, Gly, Asp, Gly, Gin, Leu, Leu Val, His, Leu, Thr, Pro, Glu, Glu O Val, Gly, Asp, Thr, Pro, Glu, Glu O Leu, Glu, Asp, Gly, Gin, Leu, Leu
Under what conditions will the following partial diploid strain of E. coli convert chorismate to tryptophan (assume trp mutants function similarly to lac mutants)? trpR* trpP trpO* trpE* trpD* trpC* trpB* trpA*/ trpR trpP trpO° trpE trpD trpC trpB trpA ect the one BEST answer (2 oints! O never O only when tryptophan levels are low O constitutively O only when tryptophan is present O only when chorismate levels are low
Eight mutant bacteriophage strains cannot lyse a certain type of bacteria that can be lysed by wild-type bacteriophages. The mutant strains were allowed to infect the bacteria in a complementation test. A "+" indicates that lysis occurred with coinfection. A "-" indicates that lysis did not occur. GKWTMAQC G- ++++- K W T M A Q C - + +++ - ++++ - + + - + - + - - + + + A cistron is defined by no complementation in the How many genes are controlling lysis in this bacteriophage? (Use a number not a word in the space) configuration.
b. Which one of the following a cell mutants will be able to switch at least once? [Select]
In the Western blot shown here, proteins were isolated from redblood cells and muscle cells from two different individuals. Oneindividual was unaffected, and the other suffered from a diseaseknown as thalassemia, which involves a defect in hemoglobin. Theblot was exposed to an antibody that recognizes β globin, whichis one of the polypeptides that constitute hemoglobin. Equal totalamounts of cellular proteins were added to each lane. Explain these results.
An ade+ arg+ cys+ his+ leu+ pro+ bacterial strain is knownto be lysogenic for a newly discovered phage, but the siteof the prophage is not known. The bacterial map isleucysarghisadeproThe lysogenic strain is used as a source of the phage, andthe phages are added to a bacterial strain of genotypeade- arg- cys- his- leu- pro-. After a short incubation,samples of these bacteria are plated on six differentmedia, with the supplementations indicated in thefollowing table. The table also shows whether colonieswere observed on the various media.PresenceMedium Ade Arg Cys His Leu Pro of colonies1 - + + + + + N2 + - + + + + N3 + + - + + + C4 + + + - + + N5 + + + + - + C6 + + + + + - NNutrient supplementation in medium(In this table, a plus sign indicates the presence of anutrient supplement, a minus sign indicates that asupplement is not present, N indicates no colonies, and Cindicates colonies present.)a. What genetic process is at work here?b. What is the approximate locus of the prophage?
b. Cleavage with chymotrypsin produces the following fragments: Band A: CN , NLQY, GIVEQCCHKRSEY Band B: F, Y, DPTKM, IACCVRGF, RTTGHLCGKDLVNALY Cleavage with Staphilococcus aureus V8 protease produces the following fragments: Band A: GIVE, YNLQNYCN, QCCHKRCSE Band B: PTKM, RTTGHLCGKD, LVNALYIACGVRGFFYD What is the amino acid sequence of the protein? Type your response