Q: Part 2 Bio Question 8
A: The objective of the question is to determine where the Pitx1 gene would be expressed given a…
Q: Scientific research on coral reef restoration
A: Title: Advancing Coral Reef Restoration Through Scientific Research and Innovative TechnologiesCoral…
Q: The so-called "Age of Discovery" during the 1400s-1700s when the superiority of European cultures…
A: The question is asking whether it is true or false that the 'Age of Discovery', a period from the…
Q: In vitro experiments are conducted at pH = 7.4 to simulate physiological conditions. A phosphate…
A: (a) 1.58 (b) 9.48 gramsExplanation:
Q: 3. Module 1. Ecomorobe a. Observe the morphologies of the eight different lizard species. For now,…
A: a. You observe eight lizards, four from each of two islands. Since you lack prior knowledge of their…
Q: Why does meiosis occur?
A: Meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half…
Q: In the complete absence of light, a rod will become strongly depolarized and increase its…
A: The question is asking about the behavior of rod cells in the retina of the eye in the complete…
Q: The only living group of mammals that lay eggs rather than give birth to live young are called: A)…
A: The question is asking for the name of the group of mammals that lay eggs instead of giving birth to…
Q: The per-capita birth rate of individuals in a population is 0.8, and the per-capita death rate of…
A: The objective of the question is to determine the change in the size of a population based on the…
Q: Which molecule conveys protons from the chloroplast stroma into the thylakoid lumen? a. cytochrome…
A: The question is asking about the molecule that is responsible for transporting protons (H+ ions)…
Q: Erasistratus from Ceos identified the correct function (to prevent backward flow of blood from the…
A: The objective of the question is to identify the valve in the human heart that prevents the backward…
Q: When a
A: Oval reserves can be better than circular reserves in the context of wildlife conservation when the…
Q: What substance joins proteoglycans together into gigantic complexes called proteoglycan aggregates?…
A: The question is asking about the substance that binds proteoglycans together to form large complexes…
Q: What is the correct order of events in the left ventricle during the systole phase of the cardiac…
A: The objective of the question is to identify the correct sequence of events that occur in the left…
Q: what is the difference between biomass and waste biomass and how waste biomass is harmful to…
A: a)Biomass refers to organic materials derived from plants and animals, such as wood, crops,…
Q: List the series of events at the membrane that generate an action potential, including the…
A: The objective of the question is to understand the sequence of events that occur at the membrane to…
Q: The steep part of the O2-Hb dissociation curve... a. is where CO2 unloading occurs at the tissue…
A: The question is asking about the characteristics of the steep part of the oxygen-hemoglobin (O2-Hb)…
Q: The theory endosymbiosis is important in understanding how mitochondria and eukaryotic cells may…
A: Lynn Margulis propounded the endosymbiotic theory. According to this theory eukaryotic cells…
Q: QUESTION 1 In cucumbers, warty fruit (W) is dominant to smooth fruit (w) and dull fruit (D) is…
A: In the field of genetics, understanding how traits are inherited is often studied through crosses…
Q: If fatty acids are a more efficient storehouse of energy than glucose or glycogen, why aren't they…
A: The question is asking why fatty acids, despite being a more efficient source of energy, are not…
Q: QUESTION 10 Orange coat color in cats is due to an X-linked allele (X) that is codominant with the…
A: In a population of cats, understanding the genetic dynamics of coat color inheritance is crucial.…
Q: Based on this data, which gene is in the middle? Give the distances in map units for each of the…
A: If two or more genes are located on the same chromosome then they are classified as linked genes. In…
Q: What could the lengths of the branches on the x-axis represent? (choose all that apply, no partial…
A: The theory behind phylogenetic trees, also known as evolutionary trees, revolves around the concept…
Q: Which of the following viruses is linked to cancers: (select all that apply!) a. Hepatitis B virus…
A: The viruses linked to cancers among the options provided are:ANSWER: A. Hepatitis B virus…
Q: What is P granule and condensation of P granule?
A: P Granules:P granules are specialized ribonucleoprotein (RNP) granules found in the germ cells of…
Q: Q1
A: The question is asking about the possible sources of contamination in a product. Contamination…
Q: Scientists discovered a new species of fish. Using gel electrophoresis, they analyzed samples of DNA…
A: Part A: Based on the gel electrophoresis results, it appears that Known Species B has the most…
Q: . Describe the general structure of all cell membranes. How does this membrane structure determine…
A: 1. General Structure of Cell Membranes and Selective Permeability: Cell membranes are composed of a…
Q: Disruptive selection is the promotion of _____. the standard form of a trait…
A: Disruptive selection, also known as diversifying selection, is a type of natural selection that…
Q: Herophilus from Chalcedon identified how many chambers in the human heart? 6 chambers: the right…
A: The question is asking about the number of chambers in the human heart that were identified by…
Q: 3'- AATAAAAAAGGTCCCAAAAAATTAGGGGAGACGGTACATAAA GAGTAGAGTCATAAATTTTAGAGATGCGTA - 5'
A: Following the hints and considering the complementary strand is required:Complementary DNA strand:…
Q: Which of the following statements is false concerning the movement of fluid between capillaries and…
A: Fluid movement between capillaries and interstitial space is a fundamental physiological process,…
Q: Type of Linkage (incompletely linked, completely linked or unlinked)
A: (1) Cross: AaBb x aabb Ratio:1AB: 1Ab: 1aB: 1ab Reasoning:- The equal distribution of allele…
Q: Compared to the right ventricle, the left ventricle has all the following characteristics, except…
A: The human heart consists of four chambers, two atrium and two ventricles. The blood flows into the…
Q: The following base sequence is a complete polynucleotide made in a bacterial cell. AUG, GCC, AUG,…
A: The process of transcription entails creating mRNA from a DNA template. A complementary mRNA strand…
Q: Frequencies (in %) of mosquitoes by kdr genotype www Pre-2006 2006 Post-2006 +/+ + /r A.gambiae…
A: The inquiry is about how the kdr (knockdown resistance) genotype frequencies fluctuate over time in…
Q: Scientific research grant proposal outline on coral reef as bone replacement in humans . 1 APA…
A: Diverse underwater ecosystems known as coral reefs are mainly made up of coral polyp colonies.…
Q: Subject: Environmental Physiology Explain how the differences in the thermal characteristics of…
A: The objective of this question is to understand the impact of thermal characteristics of terrestrial…
Q: Genetics Question 7
A: The objective of the question is to understand the reason behind the difference in the production of…
Q: Compare 1. Double-helix, or single-stranded? 2. Components (nucleotides or amino acids? How many…
A: Nucleic acids are large biomolecules composed of nucleotides and have two major types -…
Q: #. What is the purpose of the respiratory system? Answer plz!
A: Respiratory system can be divided into two parts conducting part and respiratory part. Conducting…
Q: A ________ potentail is a local, graded depolarization in a receptor cell triggered by the threshold…
A: The objective of the question is to identify the type of potential that is a local, graded…
Q: Is there a single test that can reliably determine a person’s biological sex?
A: The objective of the question is to understand if there is a single, reliable test that can…
Q: Wolf reintroductions into the Yellowstone environment restored riparian species and increased…
A: Species approach focuses on the growth of particular species and it's increase in number in a…
Q: Q1: Draw the distribution of a continuous trait like dorsal fin length with a mean fin length of…
A: Definition: Polygenic inheritance is a type of inheritance pattern where a trait is influenced by…
Q: a 3d structure of protein with acces number of P02008 at uniprot database.
A: The objective of the question is to find the 3D structure of a protein with the access number P02008…
Q: Allowing all drunk-driving suspects (driving erratically) to complete the above sobriety test in 60…
A: The question is asking about the potential effects of extending the time allowed for a sobriety test…
Q: Which of the following is not a part of the red list criteria for "critically endangered" species?…
A: The Red List criteria for assessing the conservation status of species was established by the…
Q: validate Mega CRISPR WITH CRIPR
A: CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is the core technology behind…
Q: Q6.3. Imagine two new volcanic islands spring up in the middle of the ocean. Each island is quickly…
A: A hypothetical ecological situation where two new volcanic islands emerge within the sea, each…
Bacterial Genomics
The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.
Transformation Experiment in Bacteria
In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.
Plasmids and Vectors
The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.
For the plasmid below, list the origin and what antibiotic you would use for selection?
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- 70Pre-initiation begins with either TFIIF or TATA binding protein binding to the core promoter. Yesorno 71Exons tend to be non-conserved during evolution, whereas introns usually are conserved. Yesorno 72Transfer RNA molecules fold into L-shaped three-dimensional structures. YesornoGiven: BamHI, cleaves after the first G: 5’ G GATCC 3’ 3’ CCTAG G 5’ AND BclI cleaves after the first T: 5’ T GATCA 3’ 3’ ACTAG T 5’ THEN -- Given the DNA shown below: 5’ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG3’ 3’TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC5’ i) If this DNA was cut with BamHI, how many DNA fragments would you expect? ii) If the DNA shown above was cut with the enzyme BclI, how many DNA fragment would you expect?The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…
- Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′Primer1: seq1 atatatatccccccatcactgggggg Primer 2: seq2 tatatactagggtacgtatgccccccIn addition to Tc1, the C. elegans genome contains otherfamilies of DNA transposons such as Tc2, Tc3, Tc4, andTc5. Like Tc1, their transposition is repressed in thegerm line but not in somatic cells. Predict the behaviorof these elements in the mutant strains where Tc1 is nolonger repressed due to mutations in the RNAi pathway.Justify your answer.
- True or False: 1. The 6X HIS tag is required for a eukaryotic protein to be expressed in E. coli 2. BAC vectors are an appropriate choice for cloning cDNAs 3. Cluster analysis of micro-array data groups together mRNAs of similar sequence 4. In genomic DNA, on average EcoR1 restriction sites are more common than Mse1 restriction sites 5. Tags such as HA that are fused to proteins always compromise their function.5’ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’ 3’TAGCGCGATCCGCGTACGATGGATCCGATAGACGGATCGATAGCTGATTAGACTAGCTCAGTC5’ Write out the pre-mRNA for this geneWrite out the mRNA for this geneHow many amino acids does this protein have? Translate the protein Label your 5’ and 3’ UTR’se. four-base, not overlapping4. An example of a portion of the T4 rIIB gene in whichCrick and Brenner had recombined one + and one −mutation is shown here. (The RNA-like strand of theDNA is shown.)wild type 5′ AAA AGT CCA TCA CTT AAT GCC 3′mutant 5′ AAA GTC CAT CAC TTA ATG GCC 3′a. Where are the + and − mutations in the mutant DNA?b. The double mutant produces wild-type plaques.What alterations in amino acids occurred in thisdouble mutant?c. How can you explain the fact that amino acids aredifferent in the double mutant than in the wild-typesequence, yet the phage has a wild-type phenotype?
- Dyskeratosis congenita (DKC) is a rare human genetic disorderaffecting telomere replication. Mutations in the genesencoding the protein or RNA subunits of telomerase resultin very short telomeres. DKC symptoms include bone marrow failure(reduced production of blood cells) and anemia. If symptoms aresevere, a bone marrow transplant may be the only form of effectivetreatment. In one case, clinicians recommended that a 27-yearoldwoman with a dominant form of DKC undergo a bone marrowtransplant to treat the disorder. Her four siblings were tested, andher 13-year-old brother was identified as the best immunologicallymatched donor. However, before being tested, he was emphaticthat he did not want to know if he had DKC. During testing, it wasdiscovered that he had unusually short telomeres and would mostlikely develop symptoms of DKC. Although the brother is an immunologically matched donor forhis sister, it would be unethical for the clinicians to transplantbone marrow from the brother to…Dyskeratosis congenita (DKC) is a rare human genetic disorderaffecting telomere replication. Mutations in the genesencoding the protein or RNA subunits of telomerase resultin very short telomeres. DKC symptoms include bone marrow failure(reduced production of blood cells) and anemia. If symptoms aresevere, a bone marrow transplant may be the only form of effectivetreatment. In one case, clinicians recommended that a 27-yearoldwoman with a dominant form of DKC undergo a bone marrowtransplant to treat the disorder. Her four siblings were tested, andher 13-year-old brother was identified as the best immunologicallymatched donor. However, before being tested, he was emphaticthat he did not want to know if he had DKC. During testing, it wasdiscovered that he had unusually short telomeres and would mostlikely develop symptoms of DKC. Why might mutations in genes encoding telomerase subunitslead to bone marrow failure?The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant. The TATA box and kozak sequences are in parenthesis. What type of mutation is present? Wild-type:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’ Mutant:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGC AGAGCATACTGAGGGTAGTAG-3’ Answer: Is this a transition mutation? because there is an exchange of G instead of A? It kind of confuses me a little. help