Q: Aristotle classified all cold-blooded egg-laying tetrapod vertebrates as: the oviparous quadrupeds…
A: The objective of the question is to identify the category under which Aristotle classified all…
Q: Draw the mechanism of action of an HIV protease. Label the substrate, the intermediates, and the…
A: HIV protease catalyzes peptide bond hydrolysis of proteins by using water. The enzyme has two…
Q: Your animal cell culture laboratory suddenly suffered from a bacterial contamination. Several…
A: B. The media is probably contaminated with Mycoplasma, due to the lack of cell walls they are the…
Q: Describe what is meant by the term "superorganism" and provide an example.
A: SuperorganismA superorganism is a complex entity formed by the cooperation of numerous individuals,…
Q: Explain how life is in the blood by using at least 5 biological key terms such as plasma,platelets,…
A: Biological Explanation:In the context of biology, life in the blood is intricately tied to its…
Q: What is the role of the liver in bilirubin metabolism? O a. The liver converts bilirubin into…
A: Hormones are biochemical messengers that help your body coordinate its various processes. Several…
Q: Nissl bodies correspond to which of the following cytoplasmic organelles? A. Golgi apparatus B.…
A: The question is asking to identify the cytoplasmic organelle that corresponds to Nissl bodies.
Q: 9 7 13 14 20 20 2 6 3 110 15 16 16 S 11 12 17 18 19 19 22 23 33 15 22 21 21 27 27 28 24 29 30 30 25…
A: Within the study of evolutionary science, one critical aspect is the timing of significant occasions…
Q: In Aristotle’s scala naturae, which of the following animal groups possess all four types of “souls”…
A: The question is asking us to identify which group of animals, according to Aristotle's scala…
Q: 4. A binds with 5. What enzyme prevents recoiling of the DNA strand while synthesis is occurring?…
A: 4. A binds __ with C binds with ___.explanationAdenine (A) always pairs with Thymine (T), and…
Q: Q6.9. Wolves were hunted to extinction about a century ago in the eastern U.S. and Canada. Recently,…
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: Exercise 1.1 An Experiment In this exercise you will be conducting a thought experiment. That is,…
A: Lack of Control Group: The experiment did not include a control group of plants that were not talked…
Q: 80 Refer to figure 1A of the Science Article. The reduction in animal weight with exposure to higher…
A: The objective of the question is to interpret the data given in the figure 1A of the Science Article…
Q: Give correct typing answer with explanation
A: A triglyceride is composed of two main components such as glycerol and fatty acid.Explanation:A…
Q: interpret the first principal component and justify whether, besides centering, the data was (or…
A: A statistical strategy called principal component analysis (PCA) is utilized to reduce the…
Q: Compare the food labels of almond milk unsweetened and almond milk sweetened with vanilla. Name two…
A: The objective of the question is to compare the food labels of unsweetened almond milk and vanilla…
Q: Innovations in Plant-based Industries-the role of plant-based foods in the health and well-being of…
A: Plant-based Innovation: Pea Protein for Muscle Health in Aging AdultsProduct: Pea Protein Powder…
Q: In which of the following organs are fenestrated endothelial cells common? A. Heart B. Liver C.…
A: The question is asking us to identify the organ where fenestrated endothelial cells are commonly…
Q: The molecular structures of linoleic acid and palmitic acid, two naturally occurring substances, are…
A: To identify which molecule is more likely to be solid at normal temperature using the chemical…
Q: A brief introduction covering the role of Ca2+ channels in the heart and of what is known currently…
A: Calcium ion (Ca2+) channels play a crucial role in regulating the electrical activity of the heart…
Q: Which of the following does cytosine pair with? Please select all that apply. No partial credit.…
A: Answer: GuanineThe explanation is given below. If you have any further queries or needed extra…
Q: Select all the correct answers. Which two statements are true for the leading strand in DNA? n ப It…
A: During DNA replication, the double helix unwinds and each strand serves as a template for creating a…
Q: Rose plants are octoploid (octo = 8). Gametes from a rose plant contain 40 chromosomes. Indicate…
A: The correct statements are:The number of chromatids in a rose plant cell at G2 of the cell cycle is…
Q: How does distance of the light source relate to the changes in diversity of plant life in different…
A: The distance of the light source (sun) affects plant diversity in two ways: Light Intensity &…
Q: Summarize how natural selection is the mechanism that produced a global cline of skin color. Your…
A: Natural selection is the mechanism that produced a global cline of skin color. This variation in…
Q: Two cultures of a facultative anaerobe are grown in the same medium, but one culture is exposed to…
A: Facultative anaerobes can live with or without oxygen. They prefer to live in aerobic condition, but…
Q: From your graph, estimate the P50 for normal hemoglobin and the mutant corresponding to your student…
A: p50 represents the partial pressure of oxygen required to achieve 50% saturation of hemoglobin. This…
Q: what mechanism, during evolution, is most likely to have arisen
A: During evolution, the mechanism most likely to have arisen is natural selection. Natural selection…
Q: O= I Н HY " H OH ...OH A hormone with the structure shown above would be lipid-soluble water-soluble
A: LIPID-SOLUBLEExplanation:Detailed explanation: The structure shown is a CORTISONE.It is a…
Q: The classic inflammatory response (heat, swelling, redness, pain) reflects the communication of…
A: The classic inflammatory response is a complex and coordinated series of events orchestrated by the…
Q: What species of plasmodium causes the worst malaria infections
A: Several factors contribute to the 'severity' of malaria caused by certain 'Plasmodium' species.…
Q: Chronic obstructive pulmonary disease in detail what are types and classification
A: Chronic obstructive pulmonary disease (COPD) is a chronic lung disease that causes obstructed…
Q: 4. Zymogens are an interesting class of proenzymes. Describe the biochemical changes that have to…
A: Proenzymes are proteolytic in nature. They are in inactive form in blood. They are activated by…
Q: Caffeine inhibits feeding activity in tobacco hornworm larvae by inhibiting phosphodiesterase (PDE)…
A: The objective of the question is to understand how caffeine affects the feeding activity of tobacco…
Q: Give correct typing answer with explanation
A: Symptoms- Cold: - Fever: Rare - Headache: Slight - General malaise: Common and abundant - Nasal…
Q: Which of the following is an example of virus-encoded molecules modifying signal transduction…
A: The objective of the question is to identify which of the given options is an example of…
Q: 6. The banding patterns of the DNA fragments within the gel reveal that.. child 1 and child 2 cannot…
A: During DNA testing, the banding patterns are observed as it shows whether the individuals share a…
Q: DNA Isolation A. What is “cell lysis” and why would you want to lyse cells when doing a DNA…
A: A. Cell lysis is the process of breaking open the cell membrane to release the cellular contents,…
Q: Describe the function of the insulin molecule in the body.
A: Hormones are biochemical messengers that help your body coordinate its various processes. Several…
Q: The photomicrograph shows a section of synovium from the knee joint of a patient with rheumatoid…
A: The question is asking us to identify the most abundant cells in the inflammatory infiltrate of a…
Q: What is the correct order of events in the left ventricle during the systole phase of the cardiac…
A: The objective of the question is to identify the correct sequence of events that occur in the left…
Q: Is the Degradation of Xrn1 in poliovirus-infected cells an example of virus-encoded molecules…
A: No, this mechanism is a common theme in viral infection, including poliovirus infection. This is…
Q: Skin Deep: Nina Jablonski's Theory of Race ANTH 101 Video Response Questions. What is melanin?…
A: Melanin is a pigment that is produced by cells known as melanocytes in the skin of most animals,…
Q: Which structures in the diagram are part of the fish's digestive system? Press all the hotspots that…
A: Fish have a simple digestive system consisting of a mouth, pharynx, esophagus, stomach and…
Q: What makes Australopithecus sediba particularly interesting? It evolved a very large brain. It shows…
A: Australopithecus sediba is an old species of australopithecine found at Malapa Cave, Support for…
Q: Protein Synthesis and Mutation Practice Complete the lines below by determining the mRNA transcript…
A: The method of protein synthesis is central to cellular work and includes transcription and…
Q: Discovery of DNA structure A.What are Chargaff’s rules? B. What did Wilkins and Franklin provide…
A: A. Chargaff's rules refer to the observations made by Austrian biochemist Erwin Chargaff regarding…
Q: Describe how tRNA is charged with an amino acid.
A: Transfer ribonucleic acid (tRNA) is a kind of RNA molecule that unravels a courier RNA (mRNA)…
Q: Which of the following conditions is not the result of a chromosomal alteration? O Chronic…
A: Chromosomal modifications refer to variations in the structure or number of chromosomes. These…
Q: 7) Which is the best definition of osmosis? a) movement of molecules from an area of their higher…
A: Diffusion is a process by which molecules or substances move from a higher concentration to a lower…
Step by step
Solved in 3 steps
- mRNA sequence of A gene Write the amino acid sequence of the gene A. 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC Find start codon and stop codon UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.
- mRNA sequence of A gene If we have the following mutations, find the type of the mutation (silent or missense or nonsense?) 17CàU 36GàA 49GàU 115AàC 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′Examine Table 15-2. Which amino acids are coded by the following codons? (Hint: For the first base [letter] in each of the codons listed below, look at the leftmost column of the table labeled “First Base.” For the secondbase in each codon, look at the top row of bases, and for the third base, look at the column on the right-hand sideof the page).a. UUUb. UCUc. UAUd. UGCe. CUUf. CGAg. CGGh. AAAi. AAGj. GAGk. GGUl. GGCm. GGAn. GGG
- Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –GUACUAAGGAGGUUGUAUGGGUUAGGGG ACAUCAUUUUGA–3′Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’
- Typed explanation only Codons in mRNA molecule and their corresponding amino acids UUU Phenylalanine UAU tyrosine UUA leucine UAA nonsense GCA alanine AAU asparagine AAG lysine UGC cysteine GUU valine UCG, UCU serine Refer to Table 8.2. If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Group of answer choices 5' TGTGCTTTCTTA 3' 3' AGACGTTTCAAT 5' 3' UGUGCAAAGUUA 5' 5' AGAGCTTTGAAT 3' 3' TCTCGTTTGTTA 5'In the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash between each group of three bases. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGGBased on these sequences. Remove codons 24 to 66, inclusive. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGG