e. four-base, not overlapping4. An example of a portion of the T4 rIIB gene in whichCrick and Brenner had recombined one + and one −mutation is shown here. (The RNA-like strand of theDNA is shown.)wild type 5′ AAA AGT CCA TCA CTT AAT GCC 3′mutant 5′ AAA GTC CAT CAC TTA ATG GCC 3′a. Where are the + and − mutations in the mutant DNA?b. The double mutant produces wild-type plaques.What alterations in amino acids occurred in thisdouble mutant?c. How can you explain the fact that amino acids aredifferent in the double mutant than in the wild-typesequence, yet the phage has a wild-type phenotype?

e. four-base, not overlapping4. An example of a portion of the T4 rIIB gene in whichCrick and Brenner had recombined one + and one −mutation is shown here. (The RNA-like strand of theDNA is shown.)wild type 5′ AAA AGT CCA TCA CTT AAT GCC 3′mutant 5′ AAA GTC CAT CAC TTA ATG GCC 3′a. Where are the + and − mutations in the mutant DNA?b. The double mutant produces wild-type plaques.What alterations in amino acids occurred in thisdouble mutant?c. How can you explain the fact that amino acids aredifferent in the double mutant than in the wild-typesequence, yet the phage has a wild-type phenotype?

Name: e. four-base, not overlapping4. An example of a portion of the T4 rIIB
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: e. four-base, not overlapping4. An example of a portion of the T4 rIIB gene in whichCrick and Brenner had recombined one + and one −mutation is shown here. (The RNA-like strand of theDNA is shown.)wild type 5′ AAA AGT CCA TCA CTT AAT GCC 3′mutant 5′

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 9P: Heteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram...

See similar textbooks

Similar questions

For the following sequence please design an 18 base pair REVERSE primer. ATG TCA AAA GCT GTC GGT ATT GAT TTA GGT ACA ACA TAC TCG TGT GTT GCT CAC TTT GCT TAA
Suppose a single-nucleotide polymorphism occurred in the original strand to make the change shown below. Would this affect the resulting protein? Explain. This is the original strand TGG CGA GAG GGG AGC AGC TGG TAT CGC TGG GCC CAA AGG TCT TCA GGG AAT GCC This is the strand with the SNP. (The change is shown in red.) TGG CGA GAG GGG AGC AGC TAG TAT CGC TGG GCC САА AGG TCT TCA GGG AAT GCC Suppose a different single-nucleotide polymorphism occurred in the original strand to make the change shown below. Would this affect the resulting protein? Explain. This is the original strand AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TGG TAT CGC TGG GCC САА This is the mutated strand. (The change is shown in red). AGG TCT TCA GGG AAT GCC TGG CGA GAG GGA AGC AGC TGG TAT CGC TGG GCC CAA
In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertion
What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Enter just the number, nothing else! Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro- A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible (100 words max.)
Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: 5’ ATG GCT AGA GTC GAG TTG 3’ Mutant 1: 5’ ATG GCA GAG TCG AGT TG 3’ Mutant 2: 5’ ATG GCT TGA GTC GAG TTG 3’ Mutant 3: 5’ ATG GCT AGA GTT GAG TTG 3’ Mutant 4: 5’ ATG GCT AGA AGT CGA GTT G 3’ Mutant 5: 5’ ATG GCT AGA ATC GAG GTT 3’
You are working in a research lab studying human Peptide Z, which is a short protein that plays a key role in responding to SARS-CoV-2 virus infection. Your advisor gives you the double-stranded DNA sequence encoding Peptide Z (below), but she neglects to tell you which are the coding and non-coding strands of this DNA before leaving on a six-month sabbatical. 5'-AGA CCC ATG CCT CAG CAG TTC TTT GGA TTA ATG TAA-3' 3'-TCT GGG TẠC GGA GTC GTC AAG AAA CCT AAT TẠC ATT-5' Using your understand of transcription, translation, and the codon table below, determine if the top strand or bottom strand is the template strand of the Peptide Z gene. (Enter either top strand or bottom strand.) What is the sequence of the RNA that encodes Peptide Z? Note that the entire DNA sequence is transcribed. 5' - - 3' What is the amino acid sequence of Peptide Z? Make sure you indicate the carboxyl-terminus and amino-terminus with C and N, respectively.
Analyzing Cloned Sequences A base change (A to T) is the mutational event that created the mutant sickle cell anemia allele of beta globin. This mutation destroys an MstII restriction site normally present in the beta globin gene. This difference between the normal allele and the mutant allele can be detected with Southern blotting. Using a labeled beta globin gene as a probe, what differences would you expect to see for a Southern blot of the normal beta globin gene and the mutant sickle cell gene?
Heteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram the recombinational event leading to the formation of a heteroduplex DNA region within a bacteriophage chromosome.
5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA CAG GCC GGA ATT TGA - 3' There are two introns in this DNA sequence. Remember introns start with GT and end with AG. (a) How many base pairs are in intron 1 and intron 2.
In one form of thalassemia, the mutation of a single base from G to A generates a new 3' splice site that is farther upstream from the normal site. The normal and mutated sequences show the sense DNA strands of a normal and thalassemic patient. 5' CCTATTGGTCTATTTTCCACCCTTAGGCTGCTG 3' 5' CCTATTAGTCTATTTTCCACCCTTAGGCTGCTG 3' 3' end of mutated intron New start of reading frame Normal 3' end of intron What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient that results from the aberrant splicing? Use the codon table and write the peptide sequence using three-letter amino acid abbreviations separated by hyphens. amino acid sequence: Pro-The-Ser-Leu-Phe-Ser-Thr-Leu-Arg-Leu-Leu Incorrect
In a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and RNAs) always to specify base sequence in 5' > 3' direction unless otherwise directed 1. From the base sequence 5' A-T-G-C-C-A 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand 2. From the base sequence 5' T-A-A- C-C-T 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand
The table shows the partial sequences of a wild type polypeptide and three mutant polypeptides as well as the type of single nucleotide mutation that produced each mutant polypeptide. Peptide sequence Met - Leu - Arg - Ile - ... Type of mutation Wild type Met - Leu - Arg - Met - ... Met - Leu - [STOP] Mutant 1 transition Mutant 2 transversion Mutant 3 Met - Phe - Arg - Ile - ... transition Determine the mRNA sequence for the wild type polypeptide by identifying the codons that correspond to each amino acid. The first codon has been filled in for you. Codon information can be found in the codon access table. Met Leu Arg Ile Answer Bank CỦA AUA CGU CGA AUG AUC AGA UUG CÚC