Arrange the following in the order they appear in electron transport. a. FAD, coenzyme Q, cytochrome c Ob. FAD, cytochrome c, coenzyme Q Oc. Cytochrome c, FAD, coenzyme Q Od. Coenzyme Q, FAD, cytochrome c
Q: After doing the preliminary studies on redcrest protein extract, Tighnari proceeded with its…
A: Proteins are macromolecule comprised of amino acids linked by peptide bonds which forms a primary…
Q: Which enzyme activity would be inhibited if fluorodeoxyuridine-5 monophosphate is present?…
A: The compound fluorodeoxyuridine 5’-monophosphate (FdUMP) is a compound that has similar structure to…
Q: c) 1.0 1.2 Estimate Vmax and KM for all cases. What type inhibitor is [I]? Estimate K₁ and/or Kı'…
A: Enzymes are usually comprise of protein molecules which is used to catalyzed several biochemical…
Q: Uncouplers of oxidative phosphorylation are all expect: Select one: O a. thermogenin O b.…
A: INTRODUCTION: (Oxidative phosphorylation) The process by which ATP is formed as a result of the…
Q: This is the ATP accounting question. You are limited to the carbon in the following molecules:…
A: After glucose enters the cell, there are two possible fates it can undergo: enter glycolysis,…
Q: If a slight deficiency in the Vitamin B1 derivative Thiamine Pyrophosphate (TPP) leads to an…
A: TPP is a cofactor used by many enzymes. TPP helps to cleave bonds near to a carbonyl carbon.
Q: 1) Perform the necessary calculations and fill in the values in the table below (be sure to include…
A: Enzymes are usually comprise of protein molecules which is used to catalyzed several biochemical…
Q: 1) A ligand-binding protein showing negative homotropic cooperativity? a) should give an nH value…
A: Cooperativity or cooperative binding occurs when binding of one molecule influences the affinity of…
Q: Please help me calculate BSA and Net Abs (explaination and details pls)
A: Bovine Serum Albumin (BSA) is the most commonly used protein in research. It is obtained from the…
Q: Experiment: Lipids Qualitative Tests Test Performed: Translucent Test Procedure 1. Fold your…
A: Lipids are a chemically diverse group of biomolecules with two common characteristics: low…
Q: What would be the effect of a visualizing agent on the retention factor. Rf? A.Higher Rf B.Lower RF…
A: Visualising agent: The chemical agents that can be used to detect the number and location of the…
Q: Which of the designations are accurate for the fatty acid?
A: Simple fats or triglycerides are fatty acid esters of glycerol, where three fatty acid molecules are…
Q: Given: Beer-Lambert Law A = Ecl E = 8000 for Met myoglobin E= 14,000 for oxy-myoglobin l=1 cm…
A: According to Beer-Lambert law the concentration of the sample is directly proportional to the…
Q: What is the role of HCO3 in the activity of pancreatic enzymes? 2. What factors are needed in the…
A: DISCLAIMER FOR MULTIPART Since you have posted a question with multiple sub-parts, we will solve…
Q: 5. Which of the following is true about myoglobin and/or hemoglobin? O (a) The iron in Hb is in the…
A: Both hemoglobin & myoglobin are globular proteins. Our red blood cells (RBCs) are composed of…
Q: The carbon skeletons of many amino acids can be used to replenish the intermediates of the citric…
A: Since you have posted multiple MCQ questions, we will provide the solution only to the first three…
Q: The specific activity of a pure preparation of pyruvate kinase (PK) assayed in the direction of…
A: Pyruvate kinase (PK): The role of pyruvate kinase is to catalyze the final phase of glycolysis,…
Q: You are studying the DNA binding protein CLAMP and you want to determine its binding affinity for…
A: Introduction DNA acts as genetic material in our body. It is a double stranded molecule. mRNA is…
Q: Assume that you are conducting a chain-addition polymerization using 5.47 grams of monomer (MW=…
A: The number of moles is given by the ratio of the given mass in grams to the molar mass(MW) No. of…
Q: Problem. The student conducted a chemical experiment to prove the reducing properties of maltose…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: 3. With a deficiency of thiamine - vitamin B1, beriberi disease (polyneuritis) occurs and…
A: Carbohydrates consumed in diet enter the glycolytic pathway as glucose. Pyruvate is the end product…
Q: Report Table PP.7: Ninhydrin test Analysis of results for the Ninhydrin tests Glycine Tyrosine…
A: Proteins are folded peptides. Peptides are made up of amino acid residues linked via a peptide bond.…
Q: Metabolic flux is regulated by both availability of substrates and level of enzyme activity. Match…
A: Enzymes are proteins which increase the rate of biochemical reactions. They carry out the quick…
Q: Which functional groups are present in digitoxin? a. To what lipid family does the complex ring…
A: Lipids are a chemically diverse group that have two things in common: low solubility in water and…
Q: if we are able to recreate or stimulate telomerase, could humans potentially live forever?”
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: What are the greatest structural features that differentiate sphingolipids from phosphoglycerides?
A: Introducion Fatty acids are the important component of lipids. Lipid is one of the important…
Q: Substances like phencyclidine (PCP, or "angel dust") and ketamine ("Special K") are characterized…
A: INTRODUCTION : Phencyclidine : It is a synthetic drug, which is a compound being derived from…
Q: What is the function of CTAB being added to the cell culture before performing the enzyme induction…
A: Cell culture is the propagation of cells by providing a controlled physiological and physicochemical…
Q: true/ false: When proteins are denatured 1°, 2°, 3°, and 4° structure is lost.
A: Denaturation is a process in which proteins lose their original structure or confirmation. The loss…
Q: Draw the electron pushing mechanism
A: It is the three-dimensional representation of chiral centres on paper. Horizontal lines represent…
Q: What is the overall net reaction of glycolysis? C6H12O6 + 2 NADH + 2 P₁ + 2 ATP --> 2 C3H3O3 + 2…
A: In glycolysis, glucose is oxidized into pyruvate. It involves a series of enzyme-catalyzed…
Q: 15-24 b) c) Identify the molecules oxidized and reduced in the following reactions: a) CH₂CH₂CHO +…
A: Many redox reactions occur during metabolism. Redox reactions necessitate the transfer or removal of…
Q: Which enzyme in PPP creates glyceraldehyde 3 phosphate as a product? (Select all that apply)…
A: Pentose phosphate pathway (PPP) is an anabolic pathway that synthesizes pentose sugars and NADPH…
Q: ATP is a source of free energy that drives unfavorable reactions. Which of the processes are coupled…
A: The free energy changes in chemical reactions are denoted by ΔG. ∆G = ∆H − T∆S where ∆H is the…
Q: draw a diagram showing the interrelationship of Carbs-Lipids metabolism
A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…
Q: Based on your molecular weight predictions from computational analysis of the DHFR fusion proteins…
A: Glutathione S-transferase (GST): Affinity tags are efficient methods that have been employed…
Q: What mass in grams of dextrose and sodium chloride are required to prepare 250 mL of D10 NS…
A: Introduction: The term molar mass is defined as the mass of one mole of a substance. It is…
Q: describe the functions of the pentose phosphate pathway. Explain how NADPH functions in biosynthesis…
A: In a cell, glucose 6-phosphate has two possible fates: be oxidised into carbon dioxide and water by…
Q: Please describe the correlation between plasma cholesterol and atherosclerosis
A: Atherosclerosis is a heart disease caused due to the hardening and thickening of arteries by the…
Q: fatty acid designated as 20:0 is ________, while one that is designated 20:3 D5,8,11 is ________.…
A: Fatty acids are very important class of macromolecules in our body. They are the simplest type of…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: What percentage of molecules of peptide GGGG has no ionized groups (e.g. has BOTH protonated…
A: Amino acids: An amino acid can function as both an acid and a base because of its structural…
Q: precipitation until a final salt concentration of 70% was obtained. Determine the amount (in g) of…
A: Ammonium sulphate is the commonly used salt for protein precipitation and extraction. Under high…
Q: Please answer both of the following 1) The Haworth projection of D-altrose is shown What type of…
A: The cyclic structure of Glucose : The cyclic structure of furanose : The cyclic structure of…
Q: Suppose that you have decided to test whether the tyrosine residue of the spike protein is important…
A: Amino acids are the building blocks of protein. They are classified into different groups like…
Q: 4. Which of the following mutations would most likely keep the transitions of T state to R state in…
A: Amino acids are biomolecules that have a carboxyl group, an amino group and a side group linked to…
Q: Explain the importance of solubility in drug product formulation. 2.
A: Solubility, the phenomenon of dissolving a solute in a solvent to produce a homogeneous system, is…
Q: 4. If the standard reduction potential for NAD+ to NADH is -0.320 V at pH 7 and the standard…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: Briefly and in simple terms, describe the glycoside bond connecting two monosaccharides in a di- or…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: f What advantage is there to phosphoglycerate kinase having an open and closed protein…
A: Glycolysis is the 10-step enzymatic conversion of 1 molecule of six-carbon glucose to two molecules…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Arrange the following in the order they appear in electron transport. a. FAD, coenzyme Q, cytochrome c Ob. FAD, cytochrome c, coenzyme Q Oc. Cytochrome c, FAD, coenzyme Q Od. Coenzyme Q, FAD, cytochrome cAll are members of the electron transport chain, except: Select one: O a. iron-sulfur center O b. cytochrome a + a3 c. coenzyme Q O d. porphyrin ringWhich of the following statements is correct about Cytochromes? Select one: O a. Cytochrome a + a3 called cytochrome oxidase O b. Coenzyme Q is members of the cytochromes. c. the cytochrome iron atom is reversibly converted from its ferric (Fe*) to its ferrous (Fe2+) O d. Each contains a heme group
- 10. Coenzyme used in electron transport. 11. It contains an apoenzyme and a metal ion cofactor. 12. Enzyme responsible in catalyzing a transfer of group, other than hydrogen, between a pair of substrates. 13. Coenzyme of vitamin B2, Riboflavin A. NAD or NADP B. FAD or FMN C. Coenzyme A D. Thiamine pyrophosphate 14.Catalyzing interconversion of optic, geometric or positional isomers. 15. Catalyzing removal of groups from substrates by mechanisms other than hydrolysis, leaving double bonds. 16. Catalyzing linkage of 2 compounds coupled to the breaking of a pyrophosphate bond in ATP or a similar compound. 17. Aid in the hydrolysis of nucleic acids.A. anaerobic respiration Lactic acid fermentation Alcoholic fermentation Raw material Products No. of ATPS formed B. aerobic respiration Location in cell where the process takes place Number of carbon dioxxide released Number of ATPS formed Glycolysis Kreb's cycle Electron transport chain C. aerobic and anaerobic respiration anaerobic respiration aerobic respiration Raw matenal Products No. of ATPS formed Location in cell where process takes place Oxygen (presentabsent) IV. Evaluation Multiple choice Write the letter of the correct answer. 1. In which organelle does aerobic respiration take place? a Chloroplast b. Mitochondria Ribosome Nucleus C. d.1. Choose all the correct answers. Enzyme catalyzing this reaction: COO CO0 но C-H + NAD* CH2 + NADH + H* CH2 лвенный тет CoO COO L-Malate Oxaloacetate A. Belongs to the class of transferases. B. Belongs to the class of oxidoreductases. C. Is a simple enzyme. D. Is a holoenzyme.
- For the electron transport chain, all are inhibitors except: Select one: O a. Antimycin A O b. fluoroacetate Oc. Amytal O d. NaN2A microbe lives solely on acetate. It has an Electron Transport Chain driven by oxygen that has two hydrogen pumps and both NADH and FADH deliver their hydrogens (and electrons) to the first pump hence each generates 2 ATP. How many ATP are generated per acetate molecule?You have discovered a cyanobacteria with only photosystem I. The bacteria is unable to fix CO2. Explain thoroughly how you think this microorganisms makes ATP and reducing power
- Cytochrome B5 is one of many cytochrome molecules in Electron Transport Chain. How would electron transport be affected if the cell had a defective cytochrome B5 gene and did not produce functional cytochrome B5? (It will help to discuss the function of cytochromes in Electron Transport Chain in your answer!)Below show the components of the electron transport chain. Put them in the proper order from first to last. 1. Cytochrome-C Reductase 2. Cytochrome-C Oxidase 3. Ubiquinone 4. NADH Dehydrogenase 5. Cytochrome C O 1,2,3,4,5 O 4,3,1,5,2 O 4,3,2,5,1Each of the following is a high-energy product of glycolysis. From which of these can anaerobic organisms harvest the stored energy? I.e. Which of these is/are useful to an anaerobe? a ATP b NADH c Pyruvate d All of the above
