2. Scheme of anaerobic oxidation of glucose and energy balance.
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: How are GMOs applications of biotechnology?
A: Introduction:- The question is all about the genetic technology where genetic modification takes…
Q: -. Succinate dehydrogenase contains iron-sulfur centers in which irons are complexed with cysteine…
A: Succinate dehydrogenase have three 2Fe-2S centers. The 'Fe' here is complexed with the sulfur atom…
Q: DETAILS 09 Select all of the following half reactions that require energy (work) to proceed as…
A: The reactions that require energy to proceed are called endergonic reactions. The half reactions are…
Q: Draw a lipid structure. Properly label the polar and non-polar ends of the representation of a lipid…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: The structure given below represents what molecule? CHO I H-C-OH I CH₂OH dihydroxyacetone phosphate…
A: The molecular weight of glyceraldehyde, a pleasant, white, crystalline solid, is 90.08 g mol 1. 29…
Q: Describe the structural similarities and differences of the following pairs. Identify which of these…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: Metabolism is best defined as a collection of Ocellular processes that activate cell division.…
A: Biochemistry is an attempt at explaining the living cell in chemical terms. A living cell is the…
Q: The Standard free energy CAG0¹) of the reaction shown above can be estimated based on? A. High…
A: Standard free energy of a reaction (∆Go') is the amount of energy released or consumed in the…
Q: Mannose is the C-2 epimer of glucose. Altrose is the C-3 epimer of mannose. Which of the following…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: What are the general properties of Lipids? 2. How do Lipids vary from other macromolecules? 3.…
A: Lipids are a diverse class of naturally occurring compounds. Fats, waxes, fat-soluble vitamins,…
Q: Name the enzymes that catalyse (a) substrate-level phosphorylation and (b) coupled reactions during…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…
Q: Draw a lipid structure. Properly label the polar and non-polar ends of the representation of a lipid…
A: Lipids are bio molecules that are made up of fatty acids and glycerol. They are insoluble in water…
Q: Which of the following reactions does not occur mammals? O pyruvate + NADH-lactate + NAD+ O…
A: Pyruvate is the end product of glycolysis. In the presence of oxygen, it enters aerobic respiration,…
Q: In the following structure, the carbon labeled [Select] carbon, the carbon labeled [Select] is…
A: Monosaccharides are the simplest units of sugars. All monosaccharides are either aldoses or ketoses.…
Q: Structure and Function of Pyruvate Dehydrogenase Q10.2: What is the metabolic logic regarding…
A: Pyruvate dehydrogenase kinase (PDK): It is a kinase enzyme that phosphorylates the enzyme pyruvate…
Q: 4. In the space below provide a mechanism for this reaction that proceeds through the intermediate…
A: Glycolysis is the process by which one molecule of 6-carbon glucose is broken down into 2 molecules…
Q: Consider a protein with two surface-exposed histidine residues: HisA is a “typical” histidine…
A: The Henderson-Hasselbalch Equation for the deprotonation of a species is given below. pH= pKa +…
Q: Why does adding acetic acid to the milk improve the extraction efficiency of the pentobarbital? You…
A: In liquid–liquid (solvent) extraction, the solute partitions itself between two immiscible phases.…
Q: In an enzyme mechanism that generates a negative charge in the transition state, which of the…
A: When a substrate(S) binds to the active site of an enzyme(E), it leads to the formation of an ES…
Q: Select ALL statements that are true about the isoelectric point (pI) of a protein a.Protein carries…
A: The isoelectric point (pI) of a protein is the pH at which the protein is neutral or the overall…
Q: In biochemistry, what form of iron, ferric or ferrous, is most readily absorbed by the body? What…
A: Iron is a trace element that is essential for the body. Hemoglobin is a protein that transports…
Q: The structure given below represents what molecule?
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: Briefly and in simple terms, describe the glycoside bond connecting two monosaccharides in a di- or…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: A researcher found that a single point mutation in the genome of the SARS-CoV-2 virus resulted in a…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: Answer the Questions below: 1. Based on the experiment above, what is the means of detecting the…
A: Lipids are hydrophobic compounds that are usually made up of an alcohol backbone and a long chain…
Q: After doing the preliminary studies on redcrest protein extract, Tighnari proceeded with its…
A: Proteins are macromolecule comprised of amino acids linked by peptide bonds which forms a primary…
Q: 1- Catalyzes the production of FADH, in the Krebs cycle: a) isocitrate dehydrogenase b) aconitase c)…
A: The acetyl CoA molecules that are synthesized as the end product of carbohydrate, protein, and lipid…
Q: In the experimental set up to show that "CO, is given out during respiration", name the substance…
A: Respiration is a metabolic process that all organisms go through. It is a biochemical process that…
Q: Yield of ATP in complete oxidation of stearic acid including payback of transport costs using…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: How much ATP will be produced from the Beta-oxidation of lauric acid a C 12 saturated fatty acid?…
A: Lauric acid is a saturated fatty acid with 12 carbon atoms. The molecular formula of lauric acid is…
Q: What else? What are cofactors? Carboxypeptidase requires a Zn²+ cofactor for the hydrolysis of the…
A: Since in the question it is mentioned to answer any three questions, question 2, 5 & 6 will be…
Q: *Complete hydrolysis of glycerophospholipid yields equimolar amounts of glycerol, a fatty acid [16:1…
A: Lipids are classified into three groups as simple lipids, compound lipids, and derived lipids based…
Q: Which functional groups are present in digitoxin? a. To what lipid family does the complex ring…
A: Lipids are a chemically diverse group that have two things in common: low solubility in water and…
Q: 3. Attach the structures below to draw a sphingolipid. CH3-(CH2) 12-CH=CH-CH-OH sphingosine CHINH,…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: What is the overall net reaction of glycolysis? C6H12O6 + 2 NADH + 2 P₁ + 2 ATP --> 2 C3H3O3 + 2…
A: In glycolysis, glucose is oxidized into pyruvate. It involves a series of enzyme-catalyzed…
Q: EXPLAIN your choices for each of the following: a) The Hb variant least likely to cause…
A: In general, the quaternary structure of any protein is determined by the amino acids present in that…
Q: I have built an urn model for a DNA sequence. I have taken the letters from a sequence 1946…
A: DNA is composed of sequence of nucleotides (adenine, thymine, guanine and cytosine) linked by 3-5…
Q: *What are the products of saponification (hydrolysis with NaOH as the catalyst) of 1-stearoyl-2,…
A: Triglycerides are fatty acid esters of glycerols. Fatty acids are carboxylic acids with a long…
Q: With regards to hemoglobin-oxygen binding, CO2 is a [Select] modulator and 2,3-bisphosphoglycerate…
A: Positive allosteric modulators of haemoglobin -oxygen binding are the agents that stabilise R state…
Q: How do enzymes typically relate to the manipulated variables? our manipulated variables were…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: Which of these is NOT true of nucleosomes? A. Some post-translational modifications to histone…
A: Nucleosome is the basic subunit of chromatin. It is the basic unit of DNA packaging. Nucleosomes…
Q: how did you get 0.03x10^-4? Also, what is the final answer?
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…
Q: Use the sequence provided here to identify the tag and tag location for the encoded DHFR fusion…
A: DHFR fusion protein: The enzyme known as dihydrofolate reductase, or DHFR, reduces dihydrofolate to…
Q: Symport and antiport proteins must be active transport proteins A)True B)False
A: The biological membranes are selectively permeable. Transport across the biological membrane can be…
Q: Explain the growing public health threats of emerging zoonotic infections and challenges in…
A: Zoonoses are diseases and infections that are naturally transmitted between humans and vertebrate…
Q: In active muscle cells, the pO2 is about 10 torr at the cell surface and 1 torr at the mitochondria…
A: Fractional saturation (Y) is the fraction of protein that is ligand bound. Y= moles of…
Q: what is the mechanism by organophospahtes inbibit enymes?
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: How can you decrease (or stop) the rate of binding for a noncompetitive inhibitor? Could you change…
A: Non-competitive inhibitors are reversible inhibitors that binds to a site on the enzyme other than…
Q: these lipids are soluble with dichloromethane? : olive, oleic acid, stearic acid, Lecithin, Vitamin…
A: Lipids are substances that are insoluble in water and soluble in organic solvents such as alcohol…
Step by step
Solved in 3 steps
- 8. In patients with diabetes mellitus type I, the biochemical disorders result from changes in fucl metabolism. One of these signs is acidosis. Explain why such patients have a deviation of blood pH from the norm? For this me the Ocuics, name d) specify the hormone that accelerates this preeursor formation and provide appropriate charts, starting from the hormone binding to adipocyte and concluding with precursor formation, give an explanation to the charts.Discuss briefly the principle involved in the estimation of blood glucose by the glucose oxidase method.7. Explain the differences between Glycogenolysis in muscle and liver.
- 8. In patients with diabetes mellitus type I, the biochemical disorders result from changes in fuel metabolism. One of these signs is acidosis. Explain why such patients have a deviation of blood pH from the norm? For this: d) specify the hormone that accelerates this precursor formation and provide appropriate charts, starting from the hormone binding to adipocyte and concluding with precursor formation, give an explanation to the charts.1. Scheme of aerobic oxidation of glucose and energy balance.33. How can people with diabetes monitor their blood glucose levels?
- II. An unconscious man with signs of alcohol poisoning was taken to the hospital. The laboratory data of blood tests are the following: a) alcohol – 320 mg / dl (the norm - 5 mg/dl); b) glucose – 50 mg/dL; c) lactate- 2 mmol /1 (the norm-I mmol/l). What are the causes of changes in blood glucosc and lactate concentration in acute alcohol poisoning? Draw the appropriate reaction and the diagram of the process with a reduced rate in this person.explain how type 2 diabetes arises and outline some of the biochemical consequences in muscles，liver and the blood？3. A patient has got excess carbohydrate meal for the years and gain the weight. To explain this: a) draw the schemes of TAG synthesis in the liver; b) describe the transport of TAG from the liver to adipose tissue; c) describe the functions of insulin in the conversion of glucose to TAG in the liver and adipose tissue. Glucose containing Catoms was added to isolated hepatocytes inanexperiment. Ifthe glucose was added in excess, the rate of triacylglyccrol synthesis increased.
- 1. Discuss why a saturated fatty acid like lauric acid has a good anti-oxidant property. 2. Why are the essential fatty acid associated with low incidence of heart disease? Cite some clinical signs of essential fatty acid deficiency. 3. Explain how aspirin can block the synthesis of prostaglandins?11. State the effect of the following conditions to the yield of extracted glycogen (increase, decrease or no effect). Provide a brief explanation for each Condition Effect Explanation 10%HCI was used instead of 10%HOAC Chicken meat was used instead of chicken liverWhich of the following statements about insulin is true? Insulin acts as a transport protein, cany in g glucose across the cell membrane. Insulin facilitates the movement of inti acellular glucose transporters to the cell membrane. Insulin stimulates the breakdown of stored glycogen into glucose. Insulin stimulates the kidneys to reabsorb glucose into the bloodstream.
