Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
thumb_up100%
Chapter 15, Problem 24CTQ
A fragment of bacterial DNA reads:
3’
-TACCTATAATCTCAATTGATAGAAGCACTCTAC-
5’
Assuming that this fragment is the template strand, what is the sequence of mRNA that would he
transcribed? (Hint: Be sure to identify the initiation site.)
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand.
5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’
3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’
Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'
The template strand of a double helical segment of DNA consists of the following sequence:
5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’
Following translation process, what is the amino acid sequence that will be coded for? (show your answer using ONE-letter amino acid code starting from N-terminus to C-terminus)
The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR
5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’
Chapter 15 Solutions
Biology 2e
Ch. 15 - Figure 15.11 A scientist splices a eukaryotic...Ch. 15 - Figure 15.13 Errors in splicing are implicated in...Ch. 15 - Figure 15.16 Many antibiotics inhibit bacterial...Ch. 15 - The AUC and AUA codons in mRNA both specify...Ch. 15 - How many nucleotides are in 12 mRNA codons? 12 24...Ch. 15 - Which event contradicts the central dogma of...Ch. 15 - Which subunit of the E. coli polymerase confers...Ch. 15 - The -10 and -35 regions of prokaryotic promoters...Ch. 15 - Three different bacteria species have the...Ch. 15 - Which feature of promoters can be found in both...
Ch. 15 - What transcripts will be most affected by low...Ch. 15 - How do enhancers and promoters differ? Enhancers...Ch. 15 - Which pre-mRNA processing step is important for...Ch. 15 - What processing step enhances the stability of...Ch. 15 - A scientist identifies a pre-mRNA with the...Ch. 15 - The RNA components of ribosomes are synthesized in...Ch. 15 - In any given species, there are at least how many...Ch. 15 - A scientist introduces a mutation that makes the...Ch. 15 - Imagine if there were 200 commonly occurring amino...Ch. 15 - Discuss how degeneracy of the genetic code makes...Ch. 15 - A scientist sequencing itiRNA identifies the...Ch. 15 - If mRNA is complementary to the DNA template...Ch. 15 - In your own words, describe the difference between...Ch. 15 - A fragment of bacterial DNA reads: 3’...Ch. 15 - A scientist observes that a cell has an RNA...Ch. 15 - Chronic lymphocytic leukemia patients often harbor...Ch. 15 - Transcribe and translate the following DNA...Ch. 15 - Explain how single nucleotide changes can have...Ch. 15 - A normal mRNA that reads 5’ -...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Gyroscopes used in guidance systems to indicate directions must have an angular momentum that does not change i...
College Physics
A Slice of pizza has 500 kcal. If we could burn the pizza and use all the heat to warm a 50-L container of cold...
Campbell Biology in Focus (2nd Edition)
Define histology.
Fundamentals of Anatomy & Physiology Plus Mastering A&P with eText - Access Card Package (10th Edition) (New A&P Titles by Ric Martini and Judi Nath)
10. Draw the chemical structure of the three components of a nucleotide, and then link them together. What ato...
Essentials of Genetics (9th Edition) - Standalone book
True or false? Some trails are considered vestigial because they existed long ago.
Biological Science (6th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:arrow_forwardThe template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ Following translation process, what is the amino acid sequence that will be coded for? (show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus)arrow_forwardThe following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the bottom strand is template, which of the following RNA sequences would be transcribed? DNA: 5-'ATAGGCGATGCCA-3' 3'-TATCCGCTACGGT-5' O 5'-UAUCCGCUACGGU-3' O 5'-ACCGUAGCGGAUA-3' O 5'-AUAGGCGAUGCCA-3' O 5'-UGGCAUCGCCUAU-3'arrow_forward
- Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-Tyrarrow_forwardThis is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.arrow_forwardGiven the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?arrow_forward
- 2) Create an MRNA strand based on the given DNA template strand: TACTTCCTATTITCTTGTCA CCGCACT 3) Using the mRNA codon chart, determine the amino acid sequence for the MRNA sequence determined in question 3. 4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA Template Strand: TACACATCACGCTCAACT a) What would be the amino acid sequence coded for by the template strand of the DNA molecule above?arrow_forwardA fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)arrow_forwardGiven the following DNA sequence of the template (i.e. noncoding) strand for a given gene: 5'ATTGGCTGTTAGAGCGGCCGTCTAAACATCGTTGGA3' Part A) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B) Use the genetic code to write the peptide sequence translated in a cell from the mRNA synthesized in part A. Please use the 3 letter abbreviation for each amino acid.arrow_forward
- Which of these choices represents one possible corresponding mRNA sequence that can be transcribed from the following DNA template? 5′ - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3′arrow_forwardThe following fictitious double-stranded bacterial DNA sequence codes for a fictitious protein. Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads 5' to 3' right to left. Transcription begins with and includes the red underlined A/T (top strand/bottom strand) base pair. This is a bacterial sequence, so there are no introns. 5'GTGTCCGTATGATATTGTGAGATGTTATATCCCGCCGTCAACACCATAAAACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC 3′ 3' CACAGGCATACTATAACACTCTACAATATAGGGCGGCAGTTGTGGTATTTTGTCCTAT TAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG 5′ a) Which strand is used as a template for transcription, the top or the bottom? b) What are the first 15 nucleotides of the resulting mRNA? Indicate the 5' and 3' ends. c) What is the translation of the first 15 nucleotides of the mRNA? d) Do the underlined nucleotides TAA encode a stop codon for the protein? Explain. e) A mutation occurs which results in the insertion of an extra G/C (top strand/bottom…arrow_forwardHere is a DNA template strand’s sequence and direction: 3’-TACGCGGTAATC-5’ . What is the sequence and direction of mRNA synthesized from this DNA?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY