Q: Define exon and intron.
A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…
Q: This happens during DNA transcription:
A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the…
Q: TRNA has peptidal transferase activity. True False Genetic information stored in mRNA is translated…
A: A ribosome is a biological unit made up of Protein molecules and RNA that functions as the cell's…
Q: Briefly present and explain why transcribed RNA is complementary to one strand of DNA.
A: Transcription is the process by which RNA is produced from the DNA template. It is occurs within the…
Q: pathway of proteins from the nucleus
A: Proteins bound for the core (nucleus) contain NLSs. These short stretches of amino acids communicate…
Q: Explain the process of translation, including location, processes, and molecules involved
A: Replication, transcription, and translation are the basic process in the molecular dogma of the…
Q: DNA MRNA Amino Acid
A: It is on the basis of centra Dogma of molecular Biology. central dogma is the process by which DNA…
Q: Enzyme used in the synthesis of MRNA
A: 6. Enzyme used in the synthesis is mRNA - C. RNA Polymerase 7. Enzyme used during replication to…
Q: protein that charges its conformation ( and often its activity) when it binds a regulatory molecule…
A: Answer - Ligase - The RNA primer is responsible for initiation of DNA synthesis are removed by…
Q: Adenine always pairs with
A:
Q: During DNA replication in a typical human cell...
A: The method of replicating a double-stranded DNA molecule into two identical DNA molecules is known…
Q: DNA and rna structure
A: DNA is the genetic material in all the living organisms. RNA is the genetic material in only certain…
Q: DNA replication involves a
A: DNA Replication: DNA is a self replicating material which carries the genetic information of the…
Q: 17. The genetic code
A: The above given statement is about genetic code.
Q: RNA _________ Causes Gene Inactivation by Destroying the Corresponding mRNA.
A: RNA interference RNA interference(RNAi) is a mechanism that inhibits gene expression at the stage…
Q: Amino acids Codon MRNA Ribosome TRNA
A: Introduction : Translation is an important process of the central dogma. The DNA or deoxyribonucleic…
Q: The process of transcription is represented by letter
A: DNA is transcribed into mRNA and mRNA is translated into protein.
Q: During transcription
A: In transcription, enzyme RNA polymerase gets attached to DNA strand to form complementary RNA.
Q: DNA RNA PROTEIN
A: The central dogma is a molecular biology process that converts DNA to RNA and creates a functioning…
Q: Stages of mRNA translation
A: Translation is defined as an interaction by which a protein is combined via the information carried…
Q: Upstream binding factor (UBF)
A: Question 26. There are some nucleotide sequences in the promoter regions of DNA called TATA…
Q: unfold the protein
A: Protein are consist of polymers of amino acids linked by amide/peptide bonds, which is called as…
Q: Which would be more harmful to a cell, a mutation in DNA or a transcription mistake that leads to an…
A: Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) molecules are genetic materials, which are…
Q: Mutations within a DNA sequence are
A: Mutations are errors in the DNA replication process. It may be either due to mistakes when the DNA…
Q: Match the function with the appropriate protein or sequence:
A: tRNA is a short nucleotide chain with L-shaped structure. A tRNA molecule is required for…
Q: Explain the difference between an intron and an exon.
A: RNA splicing is one of the processes of post-translational modification in which introns are removed…
Q: Translation of DNA
A: Gene is the structural and functional unit of DNA. Gene is made of nucleotide base pairs. Gene is…
Q: dna and transcription
A: (Note: Question should be detailed explanation.) DNA contains the instructions for protein…
Q: Difference between transcription unit and gene.
A: The opening step in the process of gene expression is referred to as the transcription. This process…
Q: MRNA contains contains O introns O exons both exons and introns
A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…
Q: Translation of mRNA Using the codon chart provided, translate the following messenger RNA sequence…
A:
Q: Codons are...
A: Three nitrogen bases that code for a single amino acid are known as a codon. Codon show some…
Q: Explain the translation with its stages.
A: All cells use replication, transcription, and translation to keep track of their genetic material…
Q: Match the activity with the part of the gene.
A: A promoter is a DNA sequence to which proteins attach and which initiates transcription of a single…
Q: the purpuse of mRNA in regard to producing protein
A: Transcription:As deoxyribonucleic acid (DNA) is bound within the nucleus but a synthesis of protein…
Q: EXAMPLES OF DNA TRANSLATION
A: DNA translation is the process in which the DNA is first transcribed into an mRNA and then the…
Q: CHANGE OF THE PROCESSES THAT CHANGE GENETIC INFORMATION INTO ITS NEW FORM
A: Genetics is one of the diverse and widely studied branch in the field of science. It is a branch of…
Q: State silent feature of genetic code?
A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…
Q: Explanation of the transcription and translation processes.
A: The process by which the instructions contained in DNA are turned into a functioning product such as…
Q: Refer to the information on the genetic code. Use this information to determine how many amino acids…
A: The genetic code is a set of rules that living cells use to convert information found in genetic…
Q: The first nucleotide in every mRNA molecule ever produced is _________ and the first amino acid of…
A: 1. Transcription - It is the process in which mRNA is formed from one of the strands of DNA (called…
Q: transcription and translation.
A: Answer: Three general classes of RNA molecules are involved in expressing the genes encoded within…
Q: Whcih mRNA molecule will produce more protein in translation>
A: Ans- d) mRNA with a better fit to ribosomal RNA of small subunit The translation process only…
Q: Give the protein synthesized of the given mRNA sequence. No need to explain. Just give the answer.…
A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…
Q: Eukaryotic transcription and translation are similar in that both result in synthesis of
A: Answer: EUKARYOTIC = These are the organisms which have organelles present in the cell.
Q: Translate the following DNA sequence into a sequence of amino acids: TAC TAA GGA. The genetic code
A: Codon is a trinucleotide sequence of nucleic acids which corresponds to specific amino acids.…
Q: The molecule is responsible for bringing the code from DNA to the ribosome during protein synthesis.
A: Ans. The messenger RNA (mRNA), in molecular biology, is a single-stranded RNA molecule that matches…
Step by step
Solved in 2 steps with 1 images
- Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC GCG CGG UAA-3'Given the sequence below, (A) What is the transcript (MRNA) sequence? (B) What is the amino acid sequence of the translated peptide? Rather than using abbreviations, write out the entire name of each of the amino acids in your peptide, so you do not risk using the wrong abbreviation and, therefore, providing the wrong sequence. 5' - ATG CTT GTA ATA CCG TGA - 3'Translate this RNA sequence into an amino acid sequence: 5'-AUG GGC UAC CGA-3'?
- Translate the RNA codons using the given genetic code 5' A-U-C-G-A-C-G-A-U-C-C-G-A-U-C-G-A-U 3'The BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U P с > < A G U UUU UUC Phe UUA UUG CUU CUC CUA CUG L GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Cys UAA Stop UGA Stop A Trp UAG Stop UGG CAC His CGU J CGC CAA I CGA Gin CAGG CGG AAA 1 AAG Lys UGU UGC AAU Asn AGC} AAC GAC Asp GAA GAGGIU For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph V Arial G 1 AGA 1 AGG GGU GGC GGA GGG Arg Ser Arg Gly V DCAG DCA DOA UCAG Third letter 10pt < Av V IX Q ... O WORDS POWERED BY TINYThe DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter Gly
- Given the following genomic sequence which contains 2 exons and CDNA sequence predidt the amino acid sequence of the exons which are part of the coding region of a protein. How many nucleotides make up the intron? Second letter UAU TV UACJ UAA Stop|UGA Stop A UAG Stop UG Trp UUU1 Phe UUCJ UGU1, UGCJ UCU) Cys UCC Ser UCA ULA UCG CUUT CUC CUA CUG CCU CAUT C4C His CAAT CAGJ OGU CCC Leu CA CGC FArg CGA Gln CGG Pro CCG AUU AUC lle AUA ACU AGU AAU AACJ AAA 1 AAGYS Asn Ser ACC Thr ACA AGC. AGA Arg AUG Mer ACG, AGG GCU GAUT GACJ GGU GGC GUU Asp GUC Val GUA Gly Ala GAA Glu GAGJ GGA GGG GUG GCG G. Genomic antisense sequence: 5'-TAACTGATTCTAGGCTACTCTTTCACCTAA-3" CDNA sequence: 5'-TAACTGATTTCTTTCACCTAA-3" I Use the editor to format your answer First letter 皇 Third letterSupply the missing information DNA: 3' mRNA: anticodon: amino acids: TAC-CCG-TCG-GGG-CGT-ATA-ACT 5' DNA: mRNA: 5' AUG-CGA-GGC-CCU-UUA-UAA-CCC 3' codon: anticodon: amino acids:For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
- Use the genetic code table. Which amino acid is coded for by only one codon sequence? Second Position U A G UUU Phe /F UCU UAU UGU UUC Tyr/Y Cys/C UCC UAC UGC Ser /s UUA Leu /L UCA UAA STOP UGA STOP UUG UCG UAG STOP UGG CUU CCU CAU CGU CỤC His / H Leu /L CC САС Pro / P CGC CUA ССА Arg/R CAA CGA CUG Gln /Q CCG CAG CGG AUU ACU AAU AGU AUC le /i ACC Asn / N Ser /S Thr/T AAC AGC AUA ACA AAA AGA AUG Met / M ACG Lys/K Arg/R AAG AGG GUU GCU GAU GGU GUC Asp/ D G Val /v GCC Ala / A GAC GGC GUA GCA Gly/G GAA GGA GUG GCG Glu /E GAG GGG valine serine threonine isoleucine methionine MacBook PrO G Search or type URL +, #3 Third Position SCAG UCAGU CAGU CA First PositionWhat is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- G