The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter First letter DO A G U UUU UUC UUA UUG CUU CUC CUA CUG Phe GUU GUC GUA QUC Leu Leu UCU UCC UCA UCG Val CCU CCC AUU ACU AUC lle ACC AUA ACA AUG Met ACG CCA CCG GCU GCC GCA GGG Ser Pro Thr Ala CAU CAC UAU 1 UGU Cys UAC UGC UAA Stop UGA Stop A UAG Stop UGG Trp His Gin CAA CAG AAU 1 AAC AAA AAG GAU GAC Tyr GAA GAG Asn Lys Asp G Glu CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Arg Ser Arg DOA DOA DO
Q: In the figure illustrated, the sink for the material is in the atmosphere. True or false
A: Biogeochemical cycle is a cyclic pathway in which elements / nutrients are circulated in between…
Q: Which of the following statements about glycolysis is correct? a) Glycolysis is an aerobic process…
A: All metabolic changes occur in a series of events that follow a certain pattern known as the…
Q: The gene pool includes____________ Group of answer choices below: all of the fitness within a…
A: A gene pool is the collection of all the genes (including alleles) found in a population or species…
Q: A cell has a diploid chromosome number of 12. Draw a diagram of the chromosomal positioning in this…
A: Introduction : Mitosis is the name given to the process of cell division that produces the…
Q: An insect from a strain breeding for white eyes (RRww) was crossed to an insect from a strain…
A: When an organism is heterozygous, it has two distinct alleles of the same gene. For instance, pea…
Q: The lactose operon is likely to be transcribed when _____. A) there is more glucose in the cell than…
A: The initiation of transcription determines the regulation of prokaryotic genes. The regulation of…
Q: What effect would inhibitors of histone deacetylases have upon transcription? Group of answer…
A: Introduction : The protein histones is very alkaline. In eukaryotic cells, they are located in the…
Q: In snapdragons, the inheritance of flower color and size of leaves are examples of Incomplete…
A: Homozygous and heterozygous are the terms that are used to describe allele pairs. *Individuals which…
Q: This figure represents the ABC operon, which is a negative inducible operon, and its associated…
A: ANSWER: Functional structural proteins formed in the presence of molecule A are: test 1, test 2 and…
Q: conveys the most accurate information. i. Information in the histogram in panel (a) may be used to…
A: From given data it is estimated that heritability of traits ,the increment in the tail of rat is…
Q: 23. If a fly acclimated more slowly than the change in air temperature, it would pay an opportunity…
A: Acclimation is a process of adaptation in a narrow sense. Flies that rapidly acclimitize to the…
Q: Which of the following occurs during synaptic transmission? Select ALL that apply A) vesicles…
A: Introduction : A synapse is the point at which two neurons come together, or between a neuron and a…
Q: 13. A population of whiptails would adapt to environmental change faster if all reproduction were…
A: The number of individuals present in a particular area represent population. The reproduction is…
Q: Do protein levels increase or decrease as DNA methylation increases
A: DNA is the structure that stores genetic information. The genes are composed of DNA segments and…
Q: Describe (at the cellular level) how detergents like ostrasan and SDS (from solution 2 in the…
A: The molecular method for isolating plasmid DNA from bacteria is called plasmid extraction. This…
Q: please make a venn diagram about the characteristics of cats and dogs. PLEASE MAKE IT BROAD
A: Venn Diagram - A type of diagram that uses overlapping circles to represent the logical relation…
Q: TRUE or FALSe anaerobic fermentation of pyruvate occurs in the mitochondria I chose TRUE and…
A: Fermentation process takes place in cytoplasm by anaerobic microbes.
Q: Explain how the conduction pathway in the heart co-ordinates the different stages of the cardiac…
A: The atrial muscles contract as the SA node initiates the process. Doctors sometimes refer to it as…
Q: Country Italy Italy Italy Italy Italy Italy Japan Japan Japan Japan Japan Japan Year 2000 2010 2020…
A: The graph of population of countries Italy, Japan and Uganda are given with common scale in order to…
Q: The following picture drawing represents co-translation in E. coli. Answer the questions below the…
A: The question is to analyse the picture and answer the questions accordingly. Let's move on to the…
Q: 5. Suppose parent A is homozygotic for allele T at 3 loci, homozygotic for allele t at 2 loci, and…
A: Homozygous means having the same types of alleles whether dominant or recessive, while heterozygous…
Q: 8. Populations of snapping shrimp from each side of the Isthmus can now be described as two separate…
A: The process of creating new species is called speciation. A species is a group of creatures that may…
Q: Which of the following describes the most likely mechanism of membrane transport used by seawater…
A: C. Active Transport Marine fish means the fishes living in saltwater remove the salt through their…
Q: 3. An unvaccinated patient was bitten by a dog potentially infected with the rabies virus. What…
A: A certified veterinarian must provide rabies vaccination to the animal between the ages of 3 and 4…
Q: what is the ohsa limit for heat and cold exposures? At 10F what is the exposure limit ? and at 110F…
A: Employers are expected to provide employees with a place of employment that is "free from known…
Q: Which of the following statements is most directly described by the first law of thermodynamics? A B…
A: First law of thermodynamics is a kind of energy conservation law which states that energy can…
Q: How many moles of air are there in a 2.0 L bottle at 19°C and 747 mm Hg? • PV=nRT • R = 0.0821 (L…
A: Given that P = 747 mm Hg V = 2 litres T= 19°C= 273.15 + 19= 292.15 K n= number of moles. Now, PV=nRT…
Q: Ras/MAP kinase signal transduction cascade
A: MAPK signaling pathway: It is also known as the Ras-Raf-MEK-ERK pathway. It is a chain of proteins…
Q: Hemophilia, disease in which the blood lacks a clotting factor, is caused by an X linked recessive…
A: Introduction:- A pedigree is a family tree that uses symbols and lines to demonstrate genetic family…
Q: Briefly explain How does post-transcriptional regulation work in prokaryotic and euk
A: Post-transcriptional regulation is essential for controlling gene expression in highly dynamic…
Q: Problem 1: A pet storeowner mated two guinea pigs with the following results 22 black offspring 5…
A: In the given case, in case of first mating most of the offspring have black color that can be…
Q: What are defense mechanisms used by each class of Echinoderm?
A: Echinoderms comprise of five classes: Crinoidea (sea lilies), Ophiuroidea (brittle stars or snake…
Q: In tomato plants, round is dominant to elongated fruit and smooth skin is dominant to fuzzy skin. In…
A: Independently assorting refers to when two genes located on separate chromosomes show independent…
Q: 11. During sexual reproduction, the population is more likely to evolve by genetic drift. O True O…
A: Introduction:- Reproduction is the process by which offsprings are produced. Reproduction is of two…
Q: Here are the results obtained by Bridges and Morgan for crossing over analysis between black,…
A: The complete map of genes in a chromosome is called as the genetic map. It is also called chromosome…
Q: A group of patients left the clinic (where alcohol is banned) and went out for "one last drink". All…
A: Alcoholic drinks have ethanol that is digested into acetaldehyde first. It is then metabolized into…
Q: Is the DNA strand in the picture in the template or the non-template strand.
A: Deoxyribonucleic acid also called as DNA which is a polymer composed of two polynucleotide chains to…
Q: What are Phytochrome, photoreceptor, red and far-red light?
A: The research of plants, particularly their construction, characteristics, and metabolic activities,…
Q: 22. On a cold night, more flexible cell membranes will function better than less flexible ones. True…
A: Introduction:- Cell membrane is present as the outermost covering of a cell. It is made up of lipids…
Q: Why is heating important in endosperm staining procedure?
A: Staining is a technique used to make certain structures in a sample more visible under a microscope.…
Q: Climate change is becoming an ever-growing threat to human health and biology. Research an incident…
A: Introduction Long term pattern of weather in a region is called climate. Air temperature and…
Q: Q1.12. A disturbance is any relatively discrete event in time that does which of the following? A.…
A: A subfield of research called ecology includes the fields of human science, population, community,…
Q: 3. Protease inhibitors, O inhibit processing of long polypeptide chains O inhibit reverse…
A: Introduction A substance that increase the rate of a reaction or catalyze a reaction without being…
Q: How is Bicarbonate move back and forth from the plasma and red blood cells? Why is this important?…
A: Enzyme carbonic anhydrase transforms carbon dioxide into carbonic acid inside red blood cells…
Q: If the null hypothesis is correct, predict how the proportion of young cacti with nurse plants will…
A: The hypothesis is a supposition and explanation that is proposed. The hypothesis is made on the…
Q: The Great Divide When the Isthmus of Panama closed about 3 million years ago, it created a land…
A: A population is defined as a group of individuals of the same species living and interbreeding…
Q: Discuss the diversity of gas exchange you have observed in Arthropoda?
A: Arthropoda is largest phylum of the kingdom Animalia which includes insects. Word Arthropoda is…
Q: 1 4 H 11 Quadrat sampling is a method by which organisms in a certain proportion (sample) of the…
A: Quadrant sampling is the method which is used to count the number of organisms' population in a…
Q: 14. Researchers discover that New Mexican whiptails mated with a different species of lizard several…
A: The New Mexican whiptails mated with different species of lizards. The population of New Mexican…
Q: Normally when a person consumes a product that contains lactose (such as milk or cheese), the body…
A: Galactose to glucose conversion in the body is hampered by galactosemia, a rare, inherited condition…
Step by step
Solved in 2 steps
- For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GThe BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U P с > < A G U UUU UUC Phe UUA UUG CUU CUC CUA CUG L GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Cys UAA Stop UGA Stop A Trp UAG Stop UGG CAC His CGU J CGC CAA I CGA Gin CAGG CGG AAA 1 AAG Lys UGU UGC AAU Asn AGC} AAC GAC Asp GAA GAGGIU For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph V Arial G 1 AGA 1 AGG GGU GGC GGA GGG Arg Ser Arg Gly V DCAG DCA DOA UCAG Third letter 10pt < Av V IX Q ... O WORDS POWERED BY TINYGiven the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
- 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'. 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a T, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutation 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a A, then the result will be A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutation5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'.Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT
- If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- GThis is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.On the space provided, type the translation product of wild-type gene A (use three- letter abbreviation for the amino acids; use - to indicate a peptide bond). 5' CTAATCGCCTAATCCGCTTGCGGCCAT 3'
- The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.mRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- G