Biology: The Unity and Diversity of Life (MindTap Course List)
15th Edition
ISBN: 9781337408332
Author: Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 9, Problem 3SQ
In cells, most RNA molecules are ___ ; most DNA molecules are ___ .
- a. single-stranded; double-stranded
- b. double-stranded; single-stranded
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Prokaryotes contain a ________chromosome, and eukaryotes contain ________ chromosomes.a. single-stranded circular; single-stranded linearb. single-stranded linear; single-stranded circularc. double-stranded circular; double-stranded lineard. double-stranded linear; double-stranded circular
On a single-stranded DNA, the basic units are linked to one another by _______
A. Disulfide linkages
B. Phosphoanhydride bonds
C. Phosphodiester bonds
D. Hydrogen bonds
E. Hydrophobic interactions
A DNA nucleotide is made of all of the following components except ____.
A. a nitrogen-containing base
B. deoxyribose sugar
C. phosphate
D. phospholipids
QUESTION 2
Messenger RNA carries genetic information from the chromosomes to the ____.
A. ribosomes
B. endoplasmic reticulum
C. nucleolus
D. plasmids
QUESTION 3
3. A ___ codes for a specific sequence of amino acids in a protein.
A. gene
B. nucleotide
C. polyribosome
D. nucleic acid
QUESTION 4
4. The study of the structure, function, and interaction of cellular proteins is called ____.
A. bioinformatics
B. proteomics
C. genomics
D. haplotypics
QUESTION 5
5. Free-living organisms with a foreign gene are called ____ organisms.
A. transposed
B. transmutated
C. transparent
D. transgenic
QUESTION 6
6. DNA is shaped like a/an ____.
A. alpha protein
B. double helix…
Chapter 9 Solutions
Biology: The Unity and Diversity of Life (MindTap Course List)
Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - A chromosome contains many different genes that...Ch. 9 - A binding .site for RNA polymerase is called a ___...Ch. 9 - In cells, most RNA molecules are ___ ; most DNA...Ch. 9 - Prob. 4SQCh. 9 - The main function of a DNA molecule is to ________...Ch. 9 - The main function of an mRNA molecule is to ___ ....
Ch. 9 - Prob. 7SQCh. 9 - Prob. 8SQCh. 9 - Prob. 9SQCh. 9 - Anticodons pair with ___ . a. mRNA codons b. DNA...Ch. 9 - Prob. 11SQCh. 9 - Prob. 12SQCh. 9 - Prob. 13SQCh. 9 - Energy that drives translation is provided mainly...Ch. 9 - Match the terms with the best description. ______...Ch. 9 - Researchers are designing and testing antisense...Ch. 9 - An anticodon has the sequence GCG. What amino acid...Ch. 9 - Each position of a codon can be occupied by one of...Ch. 9 - Prob. 4CTCh. 9 - Translate the .sequence of bases in the previous...Ch. 9 - Can you .spell your name (or someone else's) using...Ch. 9 - Bacteria use the.same stop codons as eukaryotes....
Additional Science Textbook Solutions
Find more solutions based on key concepts
2. Why is it that the range of resting blood pressures of humans is best represented by a bell-shaped curve co...
Human Biology: Concepts and Current Issues (8th Edition)
2. Define equilibrium population. Outline the conditions that must be met for a population to stay in genetic e...
Biology: Life on Earth (11th Edition)
Problem Set
True or False? Indicate whether each of the following statements about membrane transport is true (...
Becker's World of the Cell (9th Edition)
2. Define equilibrium population. Outline the conditions that must be met for a population to stay in genetic e...
Biology: Life on Earth
1. Genetics affects many aspects of our lives. Identify three ways genetics affects your life or the life of a ...
Genetic Analysis: An Integrated Approach (3rd Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following strands of DNA (assuming it was bound to its complementary strand to create a double-helix structure) would be the most difficult to break apart? O a. 5'- CCGCCAAGGCAT - 3' O b. 5' - CAATTAGTTAAC - 3' O C. 5'- AAATTGATATAT - 3' d. 5'- AATGCGCCGATA - 3' e. 5'- CCAGGCCGTGGA - 3'arrow_forwardTranscription copies a _____ to a complementary _____ molecule. a. chromosome; DNA c. gene; RNA b. genome; RNA d. DNA sequence; ribosomearrow_forwardWhich of the following strands of DNA (assuming it was bound to its complementary strand to create a double-helix structure) would be the least difficult to break apart? a. 5' - CCGCCGGCATATCCGAT - 3' b. 5' - CCGCGCGATCGGCGCGT - 3' c. 5' - AATGAGGCCAATTGACA - 3' d. 5' - CCACCAGGCACAGCCGA - 3' e. 5' - AAATTGATATATAGGCA - 3'arrow_forward
- 1. The coded information in a DNA molecule directly determines the formation of ____________. * a. polysaccharides b. lipids c. monosaccharides d. polypeptides 2. Transcription takes place in ______. * a. cytoplasm b. chloroplasts c. nucleus d. mitochondriaarrow_forwardThe single strand of DNA below forms a stem-loop structure structure with a loop that is 6 nucleotides long. 5’ - T A T C G C T A __ __ __ __ __ __ __ __ - 3’ What are the rest of the nucleotides? Group of answer choices a. 5’ – ATAGCATC – 3’ b. 5’ – CTACGATA – 3’ c. 5’ – AATCGTAG – 3’ d. 5’ – GATGCTAA – 3’arrow_forwardThe nucleotides from a bacterial cell were found to have the following abundances: 39% uracil; 41% adenine, 9% cytosine; 8% guanine. What type of molecule is the genome of the bacteria likely made of? a. Double stranded DNA b. Single stranded DNA c. Messenger RNA d. Double stranded RNAarrow_forward
- In a double-stranded DNA molecule, how are the sequences of each strand related to each other? The sequences are identical. The sequences are identical except that one strand nas a U where the other strand has a T. The sequences are the reverse compliment of eadh other and use the nucleotides, A, G. U, and C only. The sequences are the reverse complement of each otherarrow_forwardA DNA sequence such as the one shown below has symmetry. 5' TGGAATTGTGAGCGGATAACAATT 3 3' ACCTTAACACTCGCCTATTGTTAA 5arrow_forwardIn E. coli, the genetic material is composed of ________. linear, double-stranded DNA circular, double-stranded DNA RNA and protein circular, double-stranded RNA polypeptide chainsarrow_forward
- DNA replication is semiconservative because the ___ strand will become half of the ___ molecule. a. RNA, DNA b. template, finishedc. sense, mRNA d. codon, anticodonarrow_forwardWhich of the following statements is correct A Adenine and cytosine are pyrimidines Adenine and guanine are both purines. Adenine is a purine and uridine is a pyrimidine D Thymidine is a pyrimidinearrow_forwardA new type of nucleic acid molecule is found have a base composition of 29% adenine, 19% thymine, 21% cytosine and 31% guanine. The molecule is probably: a. single stranded DNA b. double stranded RNA c. double stranded DNA d. single stranded RNAarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY