Biology: The Unity and Diversity of Life (MindTap Course List)
14th Edition
ISBN: 9781305073951
Author: Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 9, Problem 10SQ
Up to ______ amino adds can be encoded by an mRNA that consists of 45
- a. 15
- b. 45
- c. 90
- d. 135
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
The number of codon binding sites in an mRNA-ribosome complex that can be occupied at the same time by activated tRNA molecules is; *
A. 2
B. 3
C. 4
D. 5
Which is a characteristics of the normal genetic code? *
A. one codon can code for only one amino acid
B. one amino acid can have only one codon
C. one tRNA molecule can bind to only one codon
D. one aminoacyl-tRNA synthetase can react with only one tRNA
Which of the following describes the effect of a point mutation on amino acid identity in a protein? *
A. The identity of two amino acid must change
B. The identity of one amino acid may change
C. The identity of one amino acid must change
D. The identity of one amino acid never change
Which of the following statements is true regarding introns? *…
Which translation factor mediates the aminoacyl-tRNA entry into the A site of the ribosome?
A. EF-Tu
B. EF-Ts
C. EF-G
D. IF1
Choose the correct function of tRNA.
A. TRNAS are an intermediate stage of RNA processing where introns have been removed but polyadenylation has not occurred yet
B. TRNAS are small RNAS that regulate gene expression
C. TRNAS bring amino acids to the ribosome for addition to the growing polypeptide chain
D. tRNA is a major structural component of the ribosome
Chapter 9 Solutions
Biology: The Unity and Diversity of Life (MindTap Course List)
Ch. 9 - A chromosome contains many different genes that...Ch. 9 - A binding .site for RNA polymerase is called a ___...Ch. 9 - An RNA molecule is typically ______; a DNA...Ch. 9 - RNAs form by_____; proteins form by ________. a....Ch. 9 - The main function of a DNA molecule is to ________...Ch. 9 - The main function of an mRNA molecule is to ___ ....Ch. 9 - Prob. 7SQCh. 9 - Prob. 1DAACh. 9 - Prob. 2DAACh. 9 - Prob. 3DAA
Ch. 9 - Prob. 4DAACh. 9 - Prob. 8SQCh. 9 - Anticodons pair with ___ . a. mRNA codons b. DNA...Ch. 9 - Up to ______ amino adds can be encoded by an mRNA...Ch. 9 - Prob. 11SQCh. 9 - Prob. 12SQCh. 9 - Prob. 13SQCh. 9 - Energy that drives translation is provided mainly...Ch. 9 - Match the terms with the best description. __...Ch. 9 - Researchers are designing and testing antisense...Ch. 9 - An anticodon has the sequence GCG. What amino acid...Ch. 9 - Each position of a codon can be occupied by one of...Ch. 9 - Prob. 4CTCh. 9 - Translate the .sequence of bases in the previous...Ch. 9 - Bacteria use the.same stop codons as eukaryotes....
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The degeneracy of the Genetic code is due to A. a 1 to 1 correlation between single amino acids and single nucleotides B. The fact that tRNAs can bind to mRNAs at the same time they transfer amino acids to a growing polypeptide chain C. The fact that there is only one start codon D. The fact that the code is non-overlapping E. The fact that more than one codon specifying an amino acid F. None of the abovearrow_forwardA particular triplet of bases in the anticodon strand of the tRNA is 5' - AGU - 3'. A. The corresponding codon for the mRNA is _________ (write 5’ --> 3). B. If this codon is translated, the codon specifies the addition of which amino acid? _______________________arrow_forwardWhich of the following is not a possible size (in bp) of the mature mRNA? a. 205bp b. 180bp c. 150bp d. 100bparrow_forward
- Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deletedarrow_forwardWhich of the following is the mRNA coding for the peptide trp-met-gly- ser-his? A. 5'GGUGUAUGGUCUUAC-3' B. 5'-CAUUCUGGUAUGUGG-3' C. 5'-UGGAUGGGUUCUCAU-3' D. 3'-UGGAUGGGUUCUCAU-5' E. cannot be determined since the genetic code is degeneratearrow_forwardThe AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? a. complementarity b. nonsense codons c. universality d. degeneracyarrow_forward
- Degeneracy of the genetic code denotes the existence of which of the following? A. codons that can wobble at the 5' position B. multiple codons for a single amino acid C. codons consisting of only two bases D. base triplets that do not code for any amino acid E. codons that are not overlappingarrow_forwardWhy might a single base-pair mutation in eukaryotic mRNA be less serious than one in prokaryotic mRNA? a. If the mutation occurs in the 5' end of the start site, it will not affect the gene product. b. If the mutation occurs in the exon, it will not affect the gene product. c. If the mutation occurs in the splice site of a transcript with alternative splicing, only one gene product may affected. O d. If the mutation occurs in the intron or not in the splice site of a transcript with alternative splicing, it will nc affect the gene product. O e. If the mutation occurs in the 3' end of the start site, it will not affect the gene product. OLIE STIC N 1Aarrow_forwardConsider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? * A. Asparagine- Histidine B. Lysine -Serine C. Aspartic Acid - Histidine D. Lysine-Glysine Look at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the letters in group of three. What type of mutation? * A. Deletion-Frameshift B. Insertion- frameshift C. Substitution-Deletion D. Substitution-Insertion Which of the following types of RNA is involved in the transcription phase of protein synthesis? * A. rRNA B. tRNA C. hnRNA D. no correct response A tRNA molecule has the anticodon 5' AAG 3', with which mRNA codon will this anticodon interact? * A. 5' AAG 3 B. 5' CUU 3' C. 3' GAA 5'…arrow_forward
- Consider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? * A. Asparagine- Histidine B. Lysine -Serine C. Aspartic Acid - Histidine D. Lysine-Glysine Look at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the letters in group of three. What type of mutation? * A. Deletion-Frameshift B. Insertion- frameshift C. Substitution-Deletion D. Substitution-Insertion Which of the following types of RNA is involved in the transcription phase of protein synthesis? * A. rRNA B. tRNA C. hnRNA D. no correct response A tRNA molecule has the anticodon 5' AAG 3', with which mRNA codon will this anticodon interact? * A. 5' AAG 3 B. 5' CUU 3' C. 3' GAA 5'…arrow_forwardThe figure shows the position of two of these mutations a and b. The nucleotides are altered in these 2 different swo-1 mutant alleles. Use the genetic table to describe any AA changes.Name the type of mutation and describe its effect on swo-1 mRNA and protein for each of the mutations. 3. The swo-1 a mutation (insertion between C and G). 4. The swo-1 b mutation (C-to-T mutation for indicated C). 5. The swo-1 a mutation leads to worms with more body wall muscle, whereas worms with the swo-1 b mutation are not able to move. Based on these phenotypes and the findings from questions 3 and 4, describe the role thewild-type version of this protein plays in muscle function.arrow_forwardA polypeptide is composed of 4 amino acids. How many nucleotide bases on an mRNA strand are necessary to code for the complete making of this polypeptide from initiation to termination? Be sure to include the "start" and "stop" codons. a. 18 b. 15 c. 12 d. 4arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license