Starting Out with Java: From Control Structures through Data Structures (4th Edition) (What's New in Computer Science)
4th Edition
ISBN: 9780134787961
Author: Tony Gaddis, Godfrey Muganda
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Expert Solution & Answer
Chapter 4, Problem 2MC
Program Description Answer
The println statement in the given
Hence, the correct answer is option “B”.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
C++ Programming:
Instructions
The program in Example 5-6 implements the Number Guessing Game. However, in that program, the user is given as many tries as needed to guess the correct number.
Rewrite the program so that the user has no more than five tries to guess the correct number.
Your program should print an appropriate message, such as “You win!” or “You lose!”.
Code Given:
//Flag-controlled while loop.
//Number guessing game.
#include <iostream>
#include <cstdlib>
#include <ctime>
using namespace std;
int main()
{
int num; //variable to store the random number
int guess; //variable to store the number guessed by the user
bool isGuessed; //boolean variable to control the loop
srand(time(0));
num = rand() % 100;
isGuessed = false;
while (!isGuessed)
{
cout << "Enter an integer greater"
<<" than or equal to 0 and "
<<"less than 100: ";
cin >> guess;
cout << endl;
if (guess == num)
{
cout << "You win! " <<…
Language: Python
Write a program that computes and displays the charges for a patient's hospital stay. First, the program should ask if the patient was admitted as an in-patient or an out-patient. If the patient was an in-patient the following data should be entered:
- The number of days spent in the hospital
- The daily rate
-Charges for hospital services (lab tests, etc.)
-Hospital medication charges
If the patient was an out-patient the following data should be entered:
-Charges for hospital services (lab tests, etx.)
-Hospital medication charges
Use a single, seperate function to validate that no input is less than zero. If it is, it should be re-entered before being returned.
Once the required data has been input and validated, the program should use two seperate functions to calculate the total charges. One of the functions should accept arguments for the in-patient data, which the other function accepts arguments for out-patient data. Both functions should return the total…
2. Test Scores
File: test_scores.py
Write pseudocode for the main() part of a program that asks the user to enter 4 test scores between 0 and 100, then displays a JCU grade for each score and also the average test score.
When you have written the pseudocode for main, implement your solution in Python code and test it with a range of meaningful data.
Remember that we've done the JCU grades question before, so copy your function from that practical code file.
Sample Output
Score: 3
Score: 50.5
Score: 66
Score: 100
Score 3.0, which is N
Score 50.5, which is P
Score 66.0, which is C
Score 100.0, which is HD
The average score was 54.875
Enhancements
When you have that working...
We asked for 4 scores. Have a look at your code... did you use 4 as a numeric literal or a constant?Change 4 to 3... Did you have to change the program in more than one place?If so, then you've missed one of the things we've taught...As a strong guideline: if you need to use the same literal more than once, you…
Chapter 4 Solutions
Starting Out with Java: From Control Structures through Data Structures (4th Edition) (What's New in Computer Science)
Ch. 4.1 - What will the following program segments display?...Ch. 4.2 - How many times will Hello World be printed in the...Ch. 4.2 - How many times will I love Java programming! be...Ch. 4.3 - Write an input validation loop that asks the user...Ch. 4.3 - Write an input validation loop that asks the user...Ch. 4.3 - Write an input validation loop that asks the user...Ch. 4.5 - Name the three expressions that appear inside the...Ch. 4.5 - You want to write a for loop that displays I love...Ch. 4.5 - What will the following program segments display?...Ch. 4.5 - Write a for loop that displays your name 10 times.
Ch. 4.5 - Write a for loop that displays all of the odd...Ch. 4.5 - Write a for loop that displays every fifth number,...Ch. 4.6 - Write a for loop that repeats seven times, asking...Ch. 4.6 - In the following program segment, which variable...Ch. 4.6 - Prob. 4.15CPCh. 4.10 - What is the difference between an input file and...Ch. 4.10 - What import statement will you need in a program...Ch. 4.10 - What class do you use to write data to a file?Ch. 4.10 - Write code that does the following: opens a file...Ch. 4.10 - What classes do you use to read data from a file?Ch. 4.10 - Write code that does the following: opens a file...Ch. 4.10 - You are opening an existing file for output. How...Ch. 4.10 - What clause must you write in the header of a...Ch. 4.11 - Assume x is an int variable, and rand references a...Ch. 4.11 - Assume x is an int variable, and rand references a...Ch. 4.11 - Assume x is an int variable, and rand references a...Ch. 4.11 - Assume x is a double variable, and rand references...Ch. 4 - Prob. 1MCCh. 4 - Prob. 2MCCh. 4 - Prob. 3MCCh. 4 - What is each repetition of a loop known as? a....Ch. 4 - This is a variable that controls the number of...Ch. 4 - The while loop is this type of loop. a. pretest b....Ch. 4 - The do-while loop is this type of loop. a. pretest...Ch. 4 - The for loop is this type of loop. a. pretest b....Ch. 4 - This type of loop has no way of ending and repeats...Ch. 4 - This type of loop always executes at least once....Ch. 4 - This expression is executed by the for loop only...Ch. 4 - Prob. 12MCCh. 4 - This is a special value that signals when there...Ch. 4 - To open a file for writing, you use the following...Ch. 4 - To open a file for reading, you use the following...Ch. 4 - Prob. 16MCCh. 4 - This class allows you to use the print and println...Ch. 4 - This class allows you to read a line from a file....Ch. 4 - True or False: The while loop is a pretest loop.Ch. 4 - True or False: The do-while loop is a pretest...Ch. 4 - True or False: The for loop is a posttest loop.Ch. 4 - True or False: It is not necessary to initialize...Ch. 4 - True or False: One limitation of the for loop is...Ch. 4 - True or False: A variable may be defined in the...Ch. 4 - True or False: In a nested loop, the inner loop...Ch. 4 - True or False: To calculate the total number of...Ch. 4 - // This code contains ERRORS! // It adds two...Ch. 4 - Prob. 2FTECh. 4 - // This code contains ERRORS! int choice, num1,...Ch. 4 - Prob. 4FTECh. 4 - Write a while loop that lets the user enter a...Ch. 4 - Write a do-whi1e loop that asks the user to enter...Ch. 4 - Write a for loop that displays the following set...Ch. 4 - Write a loop that asks the user to enter a number....Ch. 4 - Write a for loop that calculates the total of the...Ch. 4 - Write a nested loop that displays 10 rows of #...Ch. 4 - Convert the while loop in the following code to a...Ch. 4 - Convert the do-while loop in the following code to...Ch. 4 - Convert the following while loop to a for loop:...Ch. 4 - Convert the following for loop to a while loop:...Ch. 4 - Write an input validation loop that asks the user...Ch. 4 - Write an input validation loop that asks the user...Ch. 4 - Write nested loops to draw this pattern:Ch. 4 - Write nested loops to draw this pattern: ## # # #...Ch. 4 - Complete the following program so it displays a...Ch. 4 - Complete the following program so it performs the...Ch. 4 - Prob. 17AWCh. 4 - Prob. 18AWCh. 4 - Modify the code you wrote in Question 18 so it...Ch. 4 - Write code that opens a file named NumberList.txt...Ch. 4 - Prob. 1SACh. 4 - Why should you indent the statements in the body...Ch. 4 - Describe the difference between pretest loops and...Ch. 4 - Why are the statements in the body of a loop...Ch. 4 - Describe the difference between the while loop and...Ch. 4 - Which loop should you use in situations where you...Ch. 4 - Which loop should you use in situations where you...Ch. 4 - Which loop should you use when you know the number...Ch. 4 - Why is it critical that accumulator variables are...Ch. 4 - What is an infinite loop? Write the code for an...Ch. 4 - Prob. 11SACh. 4 - What does it mean to let the user control a loop?Ch. 4 - What is the advantage of using a sentinel?Ch. 4 - Prob. 14SACh. 4 - Describe a programming problem requiring the use...Ch. 4 - How does a file buffer increase a programs...Ch. 4 - Why should a program close a file when its...Ch. 4 - What is a files read position? Where is the read...Ch. 4 - When writing data to a file, what is the...Ch. 4 - What does the Scanner classs hasNext method return...Ch. 4 - What is a potential error that can occur when a...Ch. 4 - Prob. 22SACh. 4 - How do you open a file so that new data will be...Ch. 4 - Sum of Numbers Write a program that asks the user...Ch. 4 - Distance Traveled The distance a vehicle travels...Ch. 4 - Distance File Modify the program you wrote for...Ch. 4 - Pennies for Pay Write a program that calculates...Ch. 4 - Prob. 5PCCh. 4 - File Letter Counter Write a program that asks the...Ch. 4 - Hotel Occupancy A hotels occupancy rate is...Ch. 4 - Average Rainfall Write a program that uses nested...Ch. 4 - Population Write a program that will predict the...Ch. 4 - Largest and Smallest Write a program with a loop...Ch. 4 - Celsius to Fahrenheit Table Write a program that...Ch. 4 - Bar Chart Write a program that asks the user to...Ch. 4 - File Head Display Write a program that asks the...Ch. 4 - Line Numbers Write a program that asks the user...Ch. 4 - Uppercase File Converter Write a program that asks...Ch. 4 - Budget Analysis Write a program that asks the user...Ch. 4 - Random Number Guessing Game Write a program that...Ch. 4 - Random Number Guessing Game Enhancement Enhance...Ch. 4 - ESP Game Write a program that tests your ESP...Ch. 4 - Square Display Write a program that asks the user...Ch. 4 - Dice Game Write a program that plays a simple dice...Ch. 4 - Prob. 22PCCh. 4 - Personal Web Page Generator Write a program that...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.Similar questions
- When you perform arithmetic operations with operands of different types, such as adding an int and a float, ____________. C# chooses a unifying type for the result you must choose a unifying type for the result you must provide a cast you receive an error messagearrow_forwardvoid change( int a[]) , the compiler converts the parameter to: Select one: a. int *const a b. int &a; c. int a d. const int a; c++arrow_forward1 # Calculator.py - This program performs arithmetic, ( +. -, *. / ) on two numb 2 # Input: Interactive Summary 3 # Output: Result of arithmetic operation 4 In this lab, you complete a partially written Python program that includes a function that returns a 5 # Write performOperation function here value. The program is a simple calculator that prompts the user for two numbers and an operator ( +, -, *, or / ). 7 if -_name_- == '-_main__': numberOne = int(input("Enter the first number: ")) numberTwo = int(input("Enter the second number: ")) operation = input("Enter an operator (+ - * /): ") 8 The two numbers and the operator are passed to the function where the appropriate arithmetic 10 operation is performed. The result is then returned to where the arithmetic operation and result are 11 displayed. 12 # Call performOperation method here and store the value in "result" 13 For example, if the user enters 3, 4, and *, the following is displayed: 14 print(str(numberOne) + " " + operation +…arrow_forward
- Challenge Problem (pyhton) T E S T S C O R E S Write a program that implements a test scores program. Valid test score entries are between 0 and 100 inclusive. The program should display a welcome message and run everything through the "main" function. have the ability to enter several test scores (try a loop) and print out the total score, as well as, the average score. continuously ask for test scores until the number 99.9 has been entered. test for valid entries and the value 99.9. If a test score is valid, the program should add the current score to the total score and update the number of test scores by one (+1), otherwise it displays an error message. Note : This assignment involves the use of a while loop and if-else decision making controls. You CANNOT use the reserved keywords break and continue for any portion of this program or any program for that matter throughout this course.arrow_forwardDefine the term " pass by value " .arrow_forwardC++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…arrow_forward
- Question 2: Grade Calculation Program - designing You will write a python program to compute the final grade of a student in this course. Your program should first ask the student's name and then ask that student for their marks in all six assessment criteria in the following sequence: practice problems, tutorials, assignments, self- evaluations, tests, and final exam. All numbers entered will be a percentage (i.e., out of 100) and can have optional decimal components. Your program must compute the final Point Grade (out of 100) for this student using the correct weight assigned for each assessment criterion. Be sure to read the course outline and Lecture-0 to find the weight distribution. The next step is to convert the final point grade of that student to a letter grade according to the following (simplified) conversion table.¹ Point Grade* [90-100] [80-90) [70-80) [60-70) [50-60) Below 50 Letter Grade A+ A B C D F *A square bracket indicates that the range is inclusive at that end,…arrow_forwardProgramming language: c++ (1) Prompt the user for a string that contains two strings separated by a comma. Examples of strings that can be accepted: Jill, Allen Jill , Allen Jill,Allen Ex: Enter input string: Jill, Allen (2) Print an error message if the input string does not contain a comma. Continue to prompt until a valid string is entered. Note: If the input contains a comma, then assume that the input also contains two strings. Ex: Enter input string: Jill Allen Error: No comma in string. Enter input string: Jill, Allen (3) Extract the two words from the input string and remove any spaces. Store the strings in two separate variables and output the strings. Ex: Enter input string: Jill, Allen First word: Jill Second word: Allen (4) Using a loop, extend the program to handle multiple lines of input. Continue until the user enters q to quit. Ex: Enter input string: Jill, Allen First word: Jill Second word: Allen Enter input string: Golden , Monkey First word: Golden Second…arrow_forwardTrue/False 6. In Python, a function can return only one value.arrow_forward
- Questions: Computer-Assisted Instruction) The use of computers in education is referred to as computer- assisted instruction (CAI). Write a program that will help an elementary school student learn multiplication. Use the rand function to produce two positive one-digit integers. The program should then prompt the user with a question, such as How much is 6 times 7? The student then inputs the answer. Next, the program checks the student’s answer. If it’s correct, display the message "Very good!" and ask another multiplication question. If the answer is wrong, display the message "No. Please try again." and let the student try the same question repeatedly until the student finally gets it right. A separate function should be used to generate each new question. This function should be called once when the application begins execution and each time the user answers the question correctly. PLEASE IN C++ LANGUAGEarrow_forwardC++ program Write a program that will predict the size of a population of organisms. The program should ask the user for the starting number of organisms, their average daily population increase (as a percentage of current population), and the number of days they will multiply. A loop should display the size of the population for each day.arrow_forwardstate = !state; } Example We want to write a code when SW1 closed, the Motor run with clockwise and when SW2 close, the motor run anticlockwise.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Microsoft Visual C#Computer ScienceISBN:9781337102100Author:Joyce, Farrell.Publisher:Cengage Learning,C++ for Engineers and ScientistsComputer ScienceISBN:9781133187844Author:Bronson, Gary J.Publisher:Course Technology PtrC++ Programming: From Problem Analysis to Program...Computer ScienceISBN:9781337102087Author:D. S. MalikPublisher:Cengage Learning
Microsoft Visual C#
Computer Science
ISBN:9781337102100
Author:Joyce, Farrell.
Publisher:Cengage Learning,
C++ for Engineers and Scientists
Computer Science
ISBN:9781133187844
Author:Bronson, Gary J.
Publisher:Course Technology Ptr
C++ Programming: From Problem Analysis to Program...
Computer Science
ISBN:9781337102087
Author:D. S. Malik
Publisher:Cengage Learning