Principles of Biology
2nd Edition
ISBN: 9781259875120
Author: Robert Brooker, Eric P. Widmaier Dr., Linda Graham Dr. Ph.D., Peter Stiling Dr. Ph.D.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 21.4, Problem 1BC
Summary Introduction
To analyze: The codons representing different amino acids and propose a change that results in a silent mutation.
Introduction:
A codon is a sequence of three DNA or RNA
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A mutation that changes a C to a T causes a type of Ehlers-Danlos syndrome, forming a “stop” codon and resulting in shortened procollagen. Consult the genetic code and suggest one way that this can happen.
Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’ direction.
Use the table and write the sequence of the resulting peptide.
Is it possible for a codon to code for another amino acid?
What will be the effect if a mutation changes the codon UAU to UAA?
What is a reading frame?
If you are given a nucleotide sequence, how would you find Open Reading Frames?
DISCUSS the reason why there are leading and lagging strands in replication?
DNA mutations can affect the reading frame for the genetic code. What is a human condition caused by these mutations? Identify how the reading frame is affected.
Chapter 21 Solutions
Principles of Biology
Ch. 21.1 - Refer back to Figure 4.8. Which of the three...Ch. 21.1 - Prob. 1CCCh. 21.1 - Prob. 1TYKCh. 21.1 - Prob. 2TYKCh. 21.2 - Prob. 1CCCh. 21.2 - Prob. 1TYKCh. 21.2 - Prob. 2CCCh. 21.2 - Prob. 2TYKCh. 21.2 - Prob. 3TYKCh. 21.3 - What shared derived character is common to the...
Ch. 21.3 - Prob. 2CCCh. 21.3 - Prob. 1TYKCh. 21.3 - Prob. 2TYKCh. 21.4 - Prob. 1BCCh. 21.4 - Prob. 1CCCh. 21.4 - Prob. 1TYKCh. 21.4 - An analysis of the number of neutral genetic...Ch. 21.5 - Prob. 1CCCh. 21.5 - Which of the following is an example of horizontal...Ch. 21 - Prob. 1TYCh. 21 - Which of the following is the correct order of the...Ch. 21 - Which type of taxon consists of organisms with the...Ch. 21 - Prob. 4TYCh. 21 - Prob. 5TYCh. 21 - Prob. 6TYCh. 21 - Prob. 7TYCh. 21 - Prob. 8TYCh. 21 - The concept that the preferred hypothesis is (lie...Ch. 21 - Prob. 10TYCh. 21 - Prob. 1CCQCh. 21 - What is a molecular clock? How is it used in...Ch. 21 - Prob. 3CCQCh. 21 - Prob. 1CBQCh. 21 - Prob. 2CBQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following mRNA codons could be changed to a stop codon by a single base pair substitution in DNA ? [In other words, if you substitute one of the bases for a diferent one, it will produce a stop codon. Don't overthink this. Just look at the codon as written, and see if changing any one base leads to a stop codon]. 1. UAC (tyrosine) 2. UGG (tryptophan) 3. CGA (arginine) 4. ACU (threonine) A. 1, 2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1, 2, 3 and 4 are correctarrow_forwardConsider this nucleotide sequence of DNA strand in the image provided. If this strand is the sense strand, Give the correct nucleotide sequence of the RNA produced after transcription. If the RNA formed in #1 is already a functional mRNA and will be used to synthesize proteins, how many codons are present here that will actually code for amino acids? What is the sequence of the stop codon in this mRNA? What is the sequence of the 3rd codon in this mRNA? What is the sequence of the last codon in this mRNA that actually code for an amino acid?arrow_forwardThe sequence below represents a strand of mRNA. Draw a box around the start codon. Then use the codon table provided, translate the mRNA and write the amino acids that are coded for. Remember that the start codon also codes for an amino acid. Stop at the stop codon. There is a stop codon. If you don't find a stop codon, you've missed something important. UAUG CAUG GUUA AUCarrow_forward
- Use this genetic code table for some of the questions ahead. You do not need to memorize the code, except for the start codon (AUG = Met) and the stop codons (UAA, UAG, UGA). Which of the following statements about the genetic code is correct? A) All codons specify more than one amino acid. B) The genetic code is redundant. C) All amino acids are specified by more than one codon. D) All codons specify an amino acid.arrow_forwardTranslate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don't worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid "Q") 5' UCAACUGCGAAUCUGGAAUAU 3'arrow_forwardThe following diagram illustrates a step in the process of translation. Identify the following elements on the diagram. a. Start codonarrow_forward
- Below is a segment of RNA, transcribed from a DNA sequence. Provide an example of each kind of mutation and explain what will happen to the organism. You may choose which base to alter. Please provide the new amino acid sequence with each mutation. 5’ AUGCCUACGGACUGGCCU 3’ (Met/Pro/Thr/Asp/Trp/Pro) Use the following codon chart to help you show the translation of each sequence. a. Frameshift Mutation : b. Missense Mutation : c. Silent Mutation : d. What is the anticodon sequence of the original amino acid?arrow_forwardexplain why a mutation in the dna nucleotide sequence that corresponds to the 3rd nitrogen base in the mrna codon is not as serious as a mutation in the dna that corresponds to the first nitrogen base in the mrna codonarrow_forwardYou may wish to consult the genetic code above to answer the following question. A mutation has changed a portion of a protein coding gene that encodes a messenger RNA sequence. The original messenger RNA sequence is 5'-AUGCCCAGAGCU-3' Which mutation is a frameshift mutation that changes all of the amino acids that follow the changed sequence? O 5-AUGCCCUGAGCU-3' 05-AUGCCCCAGAGCU-3" 05-AUGCCCACAGCU-3" 05 AUGCCCAGGGCC-3"arrow_forward
- You may wish to consult the genetic code above to answer the following question. A mutation has changed a portion of a protein coding gene that encodes a messenger RNA sequence. The original messenger RNA sequence is 5-AUGCCCAGAGCU-3' Which mutation is a nonsynonymous (missense) mutation that changes a single amino acid in the encoded protein? O 5-AUGCCCAGGGCC-3' O 5'-AUGCCCUGAGCU-3' O 5'-AUGCCCACAGCU-3 5'-AUGCCCCAGAGCU-3arrow_forwardThe following diagram illustrates a step in the process of translation. Identify the following elements on the diagram. a. Stop codonarrow_forwardWhich of these molecules has multiple partial charges and thus is most soluble in water? B H HHH HHH ABCD or E CH H CHOH D CH OH A cell is specialized in producing oil and steroid hormone. Which structure would be found in large r cell? O vacuoles O peroxisome O rough endoplasmic reticulum O smooth endoplasmic reticulum The oxygen released from photosynthesis results from: Reduction of NADP* to NADPH Chemiosmosis Oxidation of water Photophosphorylationarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY