Biology 2e
Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 16, Problem 17RQ

An unprocessed pre-mRNA has the following structure.

Chapter 16, Problem 17RQ, An unprocessed pre-mRNA has the following structure. Which of the following is not a possible size

Which of the following is not a possible size (in bp) of the mature mRNA?

  1. 205bp
  2. 180bp
  3. 150bp
  4. 100bp

Blurred answer
Students have asked these similar questions
Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for. 5'-GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG 3'
For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table for reference. 5' AGUCCGUAC 3' 5' AAUUGCUUC 3'
draw mRNA sequence for the following sequence  ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG

Chapter 16 Solutions

Biology 2e

Ch. 16 - Which of the following are true of epigenetic...Ch. 16 - The binding of _____ is required for transcription...Ch. 16 - What will result from the binding of a...Ch. 16 - A scientist compares the promoter regions of two...Ch. 16 - Which of the following are involved in post...Ch. 16 - Binding of an RNA binding protein will the...Ch. 16 - An unprocessed pre-mRNA has the following...Ch. 16 - IS. Alternative splicing has been estimated to...Ch. 16 - Post-translational modifications of proteins can...Ch. 16 - A scientist mutates elF-2 to eliminate its GTP...Ch. 16 - Cancer causing genes are called transformation...Ch. 16 - Targeted therapies are used in patients with a set...Ch. 16 - Name two differences between prokaryotic and...Ch. 16 - Describe how controlling gene expression will...Ch. 16 - Describe how transcription in prokaryotic cells...Ch. 16 - What is the difference between a repressible and...Ch. 16 - In cancer cells, alteration to epigenetic...Ch. 16 - A scientific study demonstrated that rat mothering...Ch. 16 - Some autoimmune diseases show a positive...Ch. 16 - A mutation within the promoter region can alter...Ch. 16 - What could happen if a cell had too much of an...Ch. 16 - A scientist identifies a potential transcription...Ch. 16 - Describe how RBPs can prevent miRNAs from...Ch. 16 - How can external stimuli alter...Ch. 16 - Protein modification can alter gene expression in...Ch. 16 - Alternative forms of a protein can be beneficial...Ch. 16 - Changes in epigenetic modifications alter the...Ch. 16 - A scientist discovers a virus encoding a Protein X...Ch. 16 - New drugs are being developed that decrease DNA...Ch. 16 - How can understanding the gene expression pattern...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
  • Text book image
    Biology 2e
    Biology
    ISBN:9781947172517
    Author:Matthew Douglas, Jung Choi, Mary Ann Clark
    Publisher:OpenStax
    Text book image
    Biology (MindTap Course List)
    Biology
    ISBN:9781337392938
    Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
    Publisher:Cengage Learning
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY