CASE STUDY | Crippled ribosomes Diamond Blackfan anemia (DBA) is a rare, dominantly inherited syndrome characterized by bone marrow failure, birth defects, and a significant predisposition to cancer. Those affected with DBA usually develop anemia in the first year of life, have abnormal numbers of cell types in their bone marrow, and have an increased risk of developing leukemia and bone cancer. At the molecular level, DBA is caused by a mutation in any of 11 genes that encode ribosomal proteins. The common feature of all these mutations is the disruption of ribosome formation, ultimately affecting the stability or function of ribosomes. Many questions about this disorder remain to be answered. Given the central importance of ribosomes in maintaining life, how is it possible that individuals carrying mutations in ribosomal protein genes survive?

Question

Want to see more full solutions like this?

Answer 1

Textbook Question

Chapter 13, Problem 1CS

CASE STUDY | Crippled ribosomes

Diamond Blackfan anemia (DBA) is a rare, dominantly inherited syndrome characterized by bone marrow failure, birth defects, and a significant predisposition to cancer. Those affected with DBA usually develop anemia in the first year of life, have abnormal numbers of cell types in their bone marrow, and have an increased risk of developing leukemia and bone cancer. At the molecular level, DBA is caused by a mutation in any of 11 genes that encode ribosomal proteins. The common feature of all these mutations is the disruption of ribosome formation, ultimately affecting the stability or function of ribosomes.

Many questions about this disorder remain to be answered.

Given the central importance of ribosomes in maintaining life, how is it possible that individuals carrying mutations in ribosomal protein genes survive?

Expert Solution & Answer

Summary Introduction

To review:

The reason for the survival ofindividuals with mutations in ribosomal protein gene, even though ribosomes are central to survival.

Introduction:

Mutations are changes in the genome of an organism and are permanent. When these mutations occur in the coding sequences, these have devastating effects as they can cause deadly diseases. However, if the mutations occur in one of the non-coding sequences, these are not manifested. Ribosomal proteins are proteins that constitute a ribosome along with ribosomal ribonucleic acid (rRNA). Ribosomes are crucial for protein synthesis as they are involved in the process of translation.

Explanation of Solution

The rRNA genes on the DNA (deoxyribonucleic acid) are repetitive fragments found clustered in many sites on the chromosome. These repetitive clusters consist of tandem repeats. Each of the clusters of repetitive DNA is separated by a spacer DNA sequence, which does not code for any protein.

Thus, one of the reasons why individuals with mutations in these genes could survive would be that the mutations occurred in one of the non-coding spacer DNA regions. Such mutations are called as missense mutations. Even if the mutations occurred in the coding region, because of the tandem repeats and repetitive clusters on many chromosomal sites, a single mutation on one of them will not affect the individual adversely to a point that makes it fatal.

Conclusion

Thus, it can be concluded that individuals with mutations in the ribosomal genes often survive because these genes are repetitive DNA sequences and are present at many chromosomal sites. The mutation in one of them will not affect the translation greatly in the sense that protein can beform in spite of mutation in either of them. A mutation can also occur in the non-coding DNA region and not affect the protein synthesis at all.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.

Point mutations in multiple tumor suppressor proteins have been linked to cancer. For example changes in the gene for adenomatous-polyposis-coli protein (APC gene) may result in colorectal cancer. Consider the following DNA sense strand. 3'-TAC CGG TTG TGA AGC TGA ATC-5' (i) (ii) (iii) (iv) Derive the mRNA molecule from the given DNA strand sequence above, paying attention to the polarity of the molecule. Write down the polypeptide chain sequence arising from the mRNA molecule of the question above, using the table of the genetic code (Table Q1 overleaf) and indicate the C- and the N-terminus of the peptide chain. Point mutations of a cytosine (C) often lead to the dysfunction of the APC protein. Write down all possible polypeptide chains that can result from all possible DNA mutations of cytosines, disregarding a mutation in the MET/START and STOP codons. I Specify which of the point mutations identified in (d) are redundant?

GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…

Answer 2

Textbook Question

Chapter 13, Problem 1CS

CASE STUDY | Crippled ribosomes

Diamond Blackfan anemia (DBA) is a rare, dominantly inherited syndrome characterized by bone marrow failure, birth defects, and a significant predisposition to cancer. Those affected with DBA usually develop anemia in the first year of life, have abnormal numbers of cell types in their bone marrow, and have an increased risk of developing leukemia and bone cancer. At the molecular level, DBA is caused by a mutation in any of 11 genes that encode ribosomal proteins. The common feature of all these mutations is the disruption of ribosome formation, ultimately affecting the stability or function of ribosomes.

Many questions about this disorder remain to be answered.

Given the central importance of ribosomes in maintaining life, how is it possible that individuals carrying mutations in ribosomal protein genes survive?

Expert Solution & Answer

Summary Introduction

To review:

The reason for the survival ofindividuals with mutations in ribosomal protein gene, even though ribosomes are central to survival.

Introduction:

Mutations are changes in the genome of an organism and are permanent. When these mutations occur in the coding sequences, these have devastating effects as they can cause deadly diseases. However, if the mutations occur in one of the non-coding sequences, these are not manifested. Ribosomal proteins are proteins that constitute a ribosome along with ribosomal ribonucleic acid (rRNA). Ribosomes are crucial for protein synthesis as they are involved in the process of translation.

Explanation of Solution

The rRNA genes on the DNA (deoxyribonucleic acid) are repetitive fragments found clustered in many sites on the chromosome. These repetitive clusters consist of tandem repeats. Each of the clusters of repetitive DNA is separated by a spacer DNA sequence, which does not code for any protein.

Thus, one of the reasons why individuals with mutations in these genes could survive would be that the mutations occurred in one of the non-coding spacer DNA regions. Such mutations are called as missense mutations. Even if the mutations occurred in the coding region, because of the tandem repeats and repetitive clusters on many chromosomal sites, a single mutation on one of them will not affect the individual adversely to a point that makes it fatal.

Conclusion

Thus, it can be concluded that individuals with mutations in the ribosomal genes often survive because these genes are repetitive DNA sequences and are present at many chromosomal sites. The mutation in one of them will not affect the translation greatly in the sense that protein can beform in spite of mutation in either of them. A mutation can also occur in the non-coding DNA region and not affect the protein synthesis at all.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Textbook Question

Chapter 13, Problem 1CS

CASE STUDY | Crippled ribosomes

Diamond Blackfan anemia (DBA) is a rare, dominantly inherited syndrome characterized by bone marrow failure, birth defects, and a significant predisposition to cancer. Those affected with DBA usually develop anemia in the first year of life, have abnormal numbers of cell types in their bone marrow, and have an increased risk of developing leukemia and bone cancer. At the molecular level, DBA is caused by a mutation in any of 11 genes that encode ribosomal proteins. The common feature of all these mutations is the disruption of ribosome formation, ultimately affecting the stability or function of ribosomes.

Many questions about this disorder remain to be answered.

Given the central importance of ribosomes in maintaining life, how is it possible that individuals carrying mutations in ribosomal protein genes survive?

Expert Solution & Answer

Summary Introduction

To review:

The reason for the survival ofindividuals with mutations in ribosomal protein gene, even though ribosomes are central to survival.

Introduction:

Mutations are changes in the genome of an organism and are permanent. When these mutations occur in the coding sequences, these have devastating effects as they can cause deadly diseases. However, if the mutations occur in one of the non-coding sequences, these are not manifested. Ribosomal proteins are proteins that constitute a ribosome along with ribosomal ribonucleic acid (rRNA). Ribosomes are crucial for protein synthesis as they are involved in the process of translation.

Explanation of Solution

The rRNA genes on the DNA (deoxyribonucleic acid) are repetitive fragments found clustered in many sites on the chromosome. These repetitive clusters consist of tandem repeats. Each of the clusters of repetitive DNA is separated by a spacer DNA sequence, which does not code for any protein.

Thus, one of the reasons why individuals with mutations in these genes could survive would be that the mutations occurred in one of the non-coding spacer DNA regions. Such mutations are called as missense mutations. Even if the mutations occurred in the coding region, because of the tandem repeats and repetitive clusters on many chromosomal sites, a single mutation on one of them will not affect the individual adversely to a point that makes it fatal.

Conclusion

Thus, it can be concluded that individuals with mutations in the ribosomal genes often survive because these genes are repetitive DNA sequences and are present at many chromosomal sites. The mutation in one of them will not affect the translation greatly in the sense that protein can beform in spite of mutation in either of them. A mutation can also occur in the non-coding DNA region and not affect the protein synthesis at all.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Textbook Question

Chapter 13, Problem 1CS

CASE STUDY | Crippled ribosomes

Diamond Blackfan anemia (DBA) is a rare, dominantly inherited syndrome characterized by bone marrow failure, birth defects, and a significant predisposition to cancer. Those affected with DBA usually develop anemia in the first year of life, have abnormal numbers of cell types in their bone marrow, and have an increased risk of developing leukemia and bone cancer. At the molecular level, DBA is caused by a mutation in any of 11 genes that encode ribosomal proteins. The common feature of all these mutations is the disruption of ribosome formation, ultimately affecting the stability or function of ribosomes.

Many questions about this disorder remain to be answered.

Given the central importance of ribosomes in maintaining life, how is it possible that individuals carrying mutations in ribosomal protein genes survive?

Expert Solution & Answer

Summary Introduction

To review:

The reason for the survival ofindividuals with mutations in ribosomal protein gene, even though ribosomes are central to survival.

Introduction:

Mutations are changes in the genome of an organism and are permanent. When these mutations occur in the coding sequences, these have devastating effects as they can cause deadly diseases. However, if the mutations occur in one of the non-coding sequences, these are not manifested. Ribosomal proteins are proteins that constitute a ribosome along with ribosomal ribonucleic acid (rRNA). Ribosomes are crucial for protein synthesis as they are involved in the process of translation.

Explanation of Solution

The rRNA genes on the DNA (deoxyribonucleic acid) are repetitive fragments found clustered in many sites on the chromosome. These repetitive clusters consist of tandem repeats. Each of the clusters of repetitive DNA is separated by a spacer DNA sequence, which does not code for any protein.

Thus, one of the reasons why individuals with mutations in these genes could survive would be that the mutations occurred in one of the non-coding spacer DNA regions. Such mutations are called as missense mutations. Even if the mutations occurred in the coding region, because of the tandem repeats and repetitive clusters on many chromosomal sites, a single mutation on one of them will not affect the individual adversely to a point that makes it fatal.

Conclusion

Thus, it can be concluded that individuals with mutations in the ribosomal genes often survive because these genes are repetitive DNA sequences and are present at many chromosomal sites. The mutation in one of them will not affect the translation greatly in the sense that protein can beform in spite of mutation in either of them. A mutation can also occur in the non-coding DNA region and not affect the protein synthesis at all.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Textbook Question

Answer 6

Textbook Question

Answer 7

Expert Solution & Answer

Summary Introduction

To review:

The reason for the survival ofindividuals with mutations in ribosomal protein gene, even though ribosomes are central to survival.

Introduction:

Mutations are changes in the genome of an organism and are permanent. When these mutations occur in the coding sequences, these have devastating effects as they can cause deadly diseases. However, if the mutations occur in one of the non-coding sequences, these are not manifested. Ribosomal proteins are proteins that constitute a ribosome along with ribosomal ribonucleic acid (rRNA). Ribosomes are crucial for protein synthesis as they are involved in the process of translation.

Explanation of Solution

The rRNA genes on the DNA (deoxyribonucleic acid) are repetitive fragments found clustered in many sites on the chromosome. These repetitive clusters consist of tandem repeats. Each of the clusters of repetitive DNA is separated by a spacer DNA sequence, which does not code for any protein.

Thus, one of the reasons why individuals with mutations in these genes could survive would be that the mutations occurred in one of the non-coding spacer DNA regions. Such mutations are called as missense mutations. Even if the mutations occurred in the coding region, because of the tandem repeats and repetitive clusters on many chromosomal sites, a single mutation on one of them will not affect the individual adversely to a point that makes it fatal.

Conclusion

Thus, it can be concluded that individuals with mutations in the ribosomal genes often survive because these genes are repetitive DNA sequences and are present at many chromosomal sites. The mutation in one of them will not affect the translation greatly in the sense that protein can beform in spite of mutation in either of them. A mutation can also occur in the non-coding DNA region and not affect the protein synthesis at all.

Answer 8

Expert Solution & Answer

Summary Introduction

To review:

The reason for the survival ofindividuals with mutations in ribosomal protein gene, even though ribosomes are central to survival.

Introduction:

Mutations are changes in the genome of an organism and are permanent. When these mutations occur in the coding sequences, these have devastating effects as they can cause deadly diseases. However, if the mutations occur in one of the non-coding sequences, these are not manifested. Ribosomal proteins are proteins that constitute a ribosome along with ribosomal ribonucleic acid (rRNA). Ribosomes are crucial for protein synthesis as they are involved in the process of translation.

Explanation of Solution

The rRNA genes on the DNA (deoxyribonucleic acid) are repetitive fragments found clustered in many sites on the chromosome. These repetitive clusters consist of tandem repeats. Each of the clusters of repetitive DNA is separated by a spacer DNA sequence, which does not code for any protein.

Thus, one of the reasons why individuals with mutations in these genes could survive would be that the mutations occurred in one of the non-coding spacer DNA regions. Such mutations are called as missense mutations. Even if the mutations occurred in the coding region, because of the tandem repeats and repetitive clusters on many chromosomal sites, a single mutation on one of them will not affect the individual adversely to a point that makes it fatal.

Conclusion

Thus, it can be concluded that individuals with mutations in the ribosomal genes often survive because these genes are repetitive DNA sequences and are present at many chromosomal sites. The mutation in one of them will not affect the translation greatly in the sense that protein can beform in spite of mutation in either of them. A mutation can also occur in the non-coding DNA region and not affect the protein synthesis at all.

Answer 9

Expert Solution & Answer

Answer 10

Expert Solution & Answer

Answer 11

Summary Introduction

To review:

The reason for the survival ofindividuals with mutations in ribosomal protein gene, even though ribosomes are central to survival.

Introduction:

Mutations are changes in the genome of an organism and are permanent. When these mutations occur in the coding sequences, these have devastating effects as they can cause deadly diseases. However, if the mutations occur in one of the non-coding sequences, these are not manifested. Ribosomal proteins are proteins that constitute a ribosome along with ribosomal ribonucleic acid (rRNA). Ribosomes are crucial for protein synthesis as they are involved in the process of translation.

Answer 12

Explanation of Solution

The rRNA genes on the DNA (deoxyribonucleic acid) are repetitive fragments found clustered in many sites on the chromosome. These repetitive clusters consist of tandem repeats. Each of the clusters of repetitive DNA is separated by a spacer DNA sequence, which does not code for any protein.

Thus, one of the reasons why individuals with mutations in these genes could survive would be that the mutations occurred in one of the non-coding spacer DNA regions. Such mutations are called as missense mutations. Even if the mutations occurred in the coding region, because of the tandem repeats and repetitive clusters on many chromosomal sites, a single mutation on one of them will not affect the individual adversely to a point that makes it fatal.

Answer 13

Conclusion

Thus, it can be concluded that individuals with mutations in the ribosomal genes often survive because these genes are repetitive DNA sequences and are present at many chromosomal sites. The mutation in one of them will not affect the translation greatly in the sense that protein can beform in spite of mutation in either of them. A mutation can also occur in the non-coding DNA region and not affect the protein synthesis at all.

Answer 14

Ch. 13 - CASE STUDY | Crippled ribosomes Diamond Blackfan...Ch. 13 - CASE STUDY | Crippled ribosomes Diamond Blackfan...Ch. 13 - Prob. 3CS Ch. 13 - HOW DO WE KNOW? 1. In this chapter, we focused on...Ch. 13 - Review the Chapter Concepts list on p. 238. These...Ch. 13 - List and describe the role of all molecular...Ch. 13 - Contrast the roles of tRNA and mRNA during...Ch. 13 - Francis Crick proposed the adaptor hypothesis for...Ch. 13 - 6. During translation, what molecule bears the...Ch. 13 - Summarize the steps involved in charging tRNAs...

Concept explainers

Videos

Explanation of Solution

Want to see more full solutions like this?

Chapter 13 Solutions