Suppose you have just determined the DNA base sequence for an especially strong promoter In Escherichia coli and you are Interested in incorporating this sequence into an expression vector. Describe the steps you would use. What precautions are necessary to be sure that this promoter actually works as expected in its new location?
To discuss:
The incorporation of the sequence of a strong promoter in E. coli into an expression vector. Steps and precautions required to evaluate the expression of the promoter in its new location.
Concept introduction:
An expression vector is a plasmid or virus and it used for gene expression. In gene expression, the gene of interest is inserted into the expression vector, which is used to carry the gene to the host. The gene encoding protein is produced in the host organism.
Explanation of Solution
- The expression vector is used for high level gene expression of cloned genes (for example, eukaryotic genes) in prokaryotes.
- The expression vector should contain an origin of replication, marker gene, and multiple cloning sites.
- The promoter sequence must be incorporated into the expression vector.
- The expression vector should contain restriction site, where the gene of interest is inserted.
- It should help to synthesize the target protein molecule by producing the stable corresponding mRNA molecules. Therefore, strong promoter is required for binding of the RNA polymerase enzyme and that may lead to the high level of transcription.
- The promoter should control and regulate the expression of the cloned gene, because more production of foreign protein molecules may disturb the host (E. coli) and it is considered as an important precaution. In addition, this vector should contain the transcription termination region for proper mRNA production. The promoter must contain an operator sequence in its upstream region and that provide RNA polymerase binding on the promoter region.
Want to see more full solutions like this?
Chapter 12 Solutions
Brock Biology of Microorganisms (15th Edition)
- PROTEIN X HAS THE POTENTIAL FOR MEDICAL APPLICATION IN HUMAN. IT IS ORIGINALLY FROM A PLANT AND HAD BEEN SUCCESSFULLY CLONED FROM ITS GENE. AFTER MANY ATTEMPTS TO CLONE IT INTO EUKARYOTIC EXPRESSION VECTORS WERE UNSUCCESSFUL, THE RESEARCHER DECIDED TO USE E.COLI EXPRESSION VECTOR. HOW THE RECOMBINANT PROTEIN COULD BE EXPRESSED IN E.COLI EXPRESSION VECTOR.1. FACTORS AFFECTING BACTERIAL EXPRESSION SYSTEM.arrow_forwardIn bacteria, genes that are often used together are controlled by a single promoter. Explain why this is the case.arrow_forwardYou made four mutants for a promoter sequence in DNA and studied them for transcription. The results of the amount of gene expression or transcription (based on beta-Gal activity shown on Y-axis) for these DNAs (X-axis) are shown. The sequence of the wild-type and mutant DNAs, and consensus sequence from many promoters are shown here for your convenience. From this experiment you can conclude that: Nucleotide substitution can identify important bases of the binding sites or promoter in DNA (e.g., -10 and -35 promoter sequences of lac operon). True or false: Spacer (a) -10 region -35 region TTGACA Consensus sequence TATAAT Wild-type Lac promoter GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATT Mutant 1 GGCTTTACACTTTATG-TTCCGGCTCGTATGTTGTGTGGAATT Mutant 2 GGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATT Mutant 3 GGCTTTACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT Mutant 4 GGCTTGACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT (b) 700 600- 500- 400- 300- 200- 100. 0 ● True O False B-Galactosidase activity Wild-type…arrow_forward
- Termicin is a small antifungal protein in termites that is produced by cells and secreted into termite saliva in response to a pathogen. In vitro translation of the termicin-encoding gene is performed, and the effects of that product are compared to those of termicin extracted from a termite. You see that extracted termicin exhibits more antifungal behavior than in vitro translated termicin. After further analysis, you see that extracted termicin contains 3 disulfide bonds, while in vitro translated termicin contains zero. The addition of microsomes to the in vitro translation reaction results in termicin with all 3 disulfide bonds. What experimental condition is most likely responsible for this difference? A. in vitro translation was not performed at the correct temperature affecting protein folding B. a mutation occurred during in vitro translation, leading to differences in disulfide bond formation O C. the UPR can not be activated in vitro, therefore, this protein can only be…arrow_forwardNegative supercoiling of DNA favors the transcription of genes because it facilitates unwinding. However, not all promoter sites are stimulated by negative supercoiling. The promoter site for topoisomerase II itself is a noteworthy exception. Negative supercoiling decreases the rate of transcription of this gene. Propose a possible mechanism for this effect and suggest a reason why it may occur.arrow_forwardA series of exonuclease deletions were used to study the promoter of the rice hemA gene, giving the results shown below (the intact promoter is on top). Based on these results, what conclusions could you draw from each of the deletion construct, and what do you know about the nature of the promoter? Relative activity -500 Reporter gene 100% Reporter gene 180% -350 -250- Reporter gene 180% 75% -150 Reporter gene 45% Reporter gene -100 0% - 8 Reporter genearrow_forward
- Suppose that E. coli sustains a mutation in its gene for the lac operon repressor making the repressor ineffective. How would this mutation affect the bacterium's ability to catabolize lactose? Would the mutant strain have an advantage over the wild-type strain? Explain your answer. (Minimum 150 words, the document will be checked for plagiarism)arrow_forwardThe streptolysin S toxin made by S. pyogenes is encoded by a 9-gene operon, sagABCDEFGHI. Thinking about what a 3-line diagram would look like for this operon, answer the following questions. Write numeric answers only. For example, if your answer is 6 promoters, write only 6. 1) How many promoters control the expression of these genes? 2) How many locations does RNA Polymerase bind to get full expression of these genes? 3) How many ribosome binding sites are needed for full protein expression? 4) How many start codons will be needed for full protein expression? 5) How many mRNA strands will be produced with full operon expression? 6) How many proteins will be produced with full protein expression? 1arrow_forwardIn the laboratory, you want to study protein that is normally toxic to E. coli cells. You wish to grow this protein in E. coli and purify it from E. coli. Your advisor suggests cloning the gene into an expression vector that uses the araBAD promoter. Explain why is it ideal to use the araBAD promoter for expression of your gene of interest in E. coli cells?arrow_forward
- A full-length eukaryotic gene is inserted into a bacterial chromosome. The gene contains a complete promoter sequence and a functional polyadenylation sequence, and it has wild-type nucleotides throughout the transcribed region. However, the gene fails to produce a functional protein. a)List at least 3 possible reasons why this eukaryotic gene is not expressed in bacteria. b)What changes would you recommend to permit expression of this eukaryotic gene in a bacterial cell?arrow_forwardA number of mutations affect the expression of the lac operon in E. coli. The genotypes of several E. coli strains are shown below. ("+" indicates a wild-type gene with normal function and "-" indicates a loss-of-function allele.) Please predict which of the following strains would have the lowest beta-galactosidase enzyme activity, when grown in the lactose medium. Orpt o* z* r* Orpt ot z* Y OrptoztY Orrotzr OrPotz*Yarrow_forwardThe following diagram represents a transcription unit on a DNA molecule. a. Assume that this DNA molecule is from a bacterial cell. Draw the approximate locations of the promoter and terminator for this transcription unit. b. Assume that this DNA molecule is from a eukaryotic cell. Draw the approximate location of an RNA polymerase II promoter.arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education