To analyze:
The maximum number of adenosine triphosphate (ATP) molecules generated from a mole of sucrose.
Introduction:
Glycolysis is a process in which glucose is broken down and gets converted to pyruvate. This process leads to the generation of energy. Energy is released in the form of ATP. These ATP molecules help in carrying out other reactions in the body.
Explanation of Solution
Sucrose is a disaccharide made up of two monosaccharides, glucoseand fructose.
For thebreakdown of one mole of glucose, ATP can be calculated at three stages.
1. Glycolysis: 6.5 ATP (2 ATP are utilized in the preparatory phase and 4 ATParereleased by substrate-levelphosphorylation. 4.5 ATPareproduced through the conversion of 2 nicotinamide adenine dinucleotide (NADH) to 2 NAD+ through oxidative phosphorylation)
2. Pyruvate to acetyl-CoA: 5 ATP (2 NADH are converted to 2 NAD+ and 5 ATP are released).
3. Citric acid cycle: 19.5 ATP (6 NADH produce 15 ATP, 2 flavin adenine dinucleotide (FADH2)produce 3 ATP through oxidative phosphorylation and 1.5 ATP molecules are produced through the formation of guanosine triphosphate (GTP) ).
Total ATP generated through glycolysis:
The number of ATP molecules generated during the breakdown of one mole of fructosecan be calculated at three stages.
1. Fructose
After forming fructose 6-phosphate from fructose by Hexokinase IV, it enters in gluconeogenic pathway.
2. Pyruvate to acetyl-CoA: 5 ATP (2 NADH are converted to 2 NAD+ and 5 ATP are released).
3. Citric acid cycle: 19.5 ATP (6 NADH produce 15 ATP, 2 FADH2 produce 3 ATP through oxidative phosphorylation and 1.5 ATP molecules are produced through the formation of GTP).
Total ATP generated through glycolysis:
The breakdown of one mole of sucrose will generate 31 ATP from glucose and 31 ATP from fructose.
Therefore, it can be concluded that the maximum number of ATP that can be generated from one mole of sucrose is 62.
Want to see more full solutions like this?
Chapter 10 Solutions
Biochemistry: The Molecular Basis of Life
- When a 23 Carbon fatty acid is metabolized, what is the total number of (GROSS) ATP produced ?arrow_forwardIf there are 3 molecules of glucose, how many molecules of pyruvic acid are produced after glycolysis?arrow_forwardWhenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ 5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’ Which strand is the template strand?arrow_forward
- How many ATP are made from one (1) molecule of glucose during anaerobic cellular respiration (AKA fermentation)?arrow_forwardCompare the amount of ATP formed during the metabolization of glucose, proteins and a fatty acid (C16H32O16) by means of a table.arrow_forwardCalculate the total number ATP produced from a trigylceride made from Docosahexnaenoic acid, a 22-carbon fatty acid containing 6 carbon-carbon doublebonds.arrow_forward
- Fructose is a labeled on its anomeric carbon with 14C. This labeled fructose is added to muscle cells under anaerobic glycolytic conditions, and the secreted lactate is collected. Which carbon in the secreted lactate (shown below) contains the 14C label? دیده OH Carbon 2 Carbon 1 Carbon 3 No carbon contains the label.arrow_forwardIdentify how many glucose molecules will be produced from the amount of 15 G3Ps. (with solution)arrow_forwardConsider a 24:1 △cis-9 fatty acid in the mitochondrion. For each fatty acid given, determine the following. Total number of ATP deducted Total net ATParrow_forward
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON