Q: The Gulf of St. Lawrence is home to the beluga whalesThere once were thousands of belugas in this…
A: Bio accumulation: It is increase of contaminant concentration in aquatic organisms following uptake…
Q: The structure of the C4 leaf shows how mesophyll cells hug the epidermis of the leaf. hug the bundle…
A: Photorespiration is a wasteful pathway that occurs when the Calvin cycle enzyme rubisco acts on…
Q: Frog Late Blastula Self-Quiz #4 Frog Late Blastu 00 10
A: Self Quiz 3 :- 1). Blastocoel 2) Cortical pigment 3). Blastomere ( micromere nuclear) 4). Fragment…
Q: Caudal vertebrae: Describe the caudal vertebrae in your specimen regarding its shape, number of…
A:
Q: QUESTION 1 You are studying a mutant strain of e.coli. When you add lactose to the media of this…
A: Lac operon is the segment of DNA which is involved in the breaking down of lactose into glucose in…
Q: How do tunicates and lancelets get food? Are there other chordates that you are aware of that feed…
A: Introduction:- A lancelet species belonging to the Cephalochordata subphylum. Myomeres, which are…
Q: membranes line the cavities between bones in moveable joints. O Mucous O Serous Cutaneous O Synovial
A: It is important to know that a thin layer of cells cover the skin (outer layer of body),…
Q: rate of oxygen production- 350 400 450 500 550 600 650 wavelength (nm) This graph shows b. C. d. e.…
A: Photosynthesis is a metabolic process in which food (organic material ) is synthesized from raw…
Q: Alveoli are: small sacs where gas exchange takes place in the respiratory system surrounded by a net…
A: Introduction :- During the act of breathing in and out, the alveoli are where the lungs and blood…
Q: D. Fill in the table below. Determine the correct template and coding strands to properly answer…
A:
Q: To determine: Whether ribosomal RNA genes were "born" perfect.
A: Ribosomes are complex organelles that are found in all living cells and play a role in protein…
Q: Which of the following mutations will most likely cause allelic dropout when amplifying an STR…
A: Each person is marked with two alleles that are present one each STR. This allele is inherited from…
Q: Watch the following movie clip from Lord of the Rings: The Fellowship of the Ring. In this clip,…
A: Plasma membrane of the cell separates the external environment from the internal one's. This barrier…
Q: Please answer asap You are caring for a patient with pulmonary (lung) Mycobacterium tuberculosis The…
A: Pathological presentation of infection caused by bacteria Mycobacterium tuberculosis .
Q: 11. A lecture hall of 1000 students conducts the same allele frequency simulation that we conducted…
A: Allele frequency: The allele frequency is a measure of genetic variation. It generally shows us…
Q: write a short discussion
A: DNA measurement- DNA concentration measurement is a commonly performed procedure in life science and…
Q: What is molecular basis of muscle fatigue?
A: Introduction :- Muscle fatigue is a sign that your muscles' ability to perform is deteriorating with…
Q: Remember for T/F questions, either answer TRUE or FALSE, but if the answer is FALSE make sure to…
A: Rubisco stands for Ribulose Bisphosphate Carboxylase Oxygenase. It is the most abundant…
Q: First letter U C A U G Second letter UUU UCU Phe UGU UUC Cys UCC UGC UUA UCA UAA STOP UGA STOPA UUG…
A: Mutation is defined as any change in the sequence of a DNA, chromosome structure or the number of…
Q: Explain the amoeba process
A: The amoeba process is a method of cell division that results in the formation of two identical…
Q: Which muscle cells would you use more of, if you train to run a marathon? O Slow twitch cells O Fast…
A: There are three types of muscle - A. Skeletal muscle - Voluntary and striated. B. Smooth muscle -…
Q: Bone gains its rigidity from brick‑hard deposits amidst living cells. Yet we cannot build a large…
A: Bones are made up of calcium phosphate. This calcium is absorbed in the presence of Vitamin D and…
Q: Skeletal muscle contraction requires: O calcium ions O ATP O arrival of a nerve impulse all the…
A: Skeletal muscle is composed of muscle fibres which have smaller units called myofibrils. There are…
Q: Imagine you are a scientist observing rats in the wild. As the rats reproduce, rats born with white…
A: ANSWER:- One clarification is that white fur is a dominant trait, whereas black fur is recessive.AS…
Q: why are underground storage organs like onions, carrots, cassava, potatoes, etc high in carbs and…
A: Underground storage organs (USOs) are an important food source for many people around the world.…
Q: Experiment 1: An RT-PCR was run on human cells growing in tissue culture under standard conditions,…
A: PCR - Polymerase chain reaction (abbreviated PCR) is a laboratory technique for rapidly producing…
Q: The anterior structure of the Drosophila is promoted by which of the following events?* a. nanos…
A: The Drosophila embryo provides an excellent model for studying gene regulatory networks. In…
Q: Compare the reproductive organs of reptiles and birds. How are their reproductive patterns…
A: Introduction The biological system of an organism's reproductive system, often known as the genital…
Q: 2. Label the muscles on the dorsal and ventral sides of the frog. Write all the answers in the next…
A: Frog contains many muscles on their dorsal and ventral sides. These muscles are needed to perform…
Q: When the ambient (room) temperature is very high, the human body will lose heat by
A: Thermoregulation in humans is an important aspect of homeostasis. Humans have been able to adapt to…
Q: To define: The term allosteric enzyme and allosteric effector.
A: Introduction :- Enzymes are proteins that enable our bodies' metabolism, or chemical reactions, go…
Q: Based on the characteristics presented, entoprocts are closely related to which lophophorate phylum?…
A: Aquatic animals, whether invertebrates or vertebrates, are animals that live in water for most or…
Q: ODD ONE OUT: Choose the term that does NOT belong to the group then give the commonality among the…
A: Introduction Bryophytes is a proposed taxonomic division that includes the liverworts, hornworts,…
Q: (c) Use the image below to complete the following: Circle a nucleotide. Label the sugar and…
A: Deoxyribonucleic acid (DNA) is an organic chemical that contains genetic information and…
Q: 1. How does site specific recombination differ from homologous recombination? a. It requires a…
A: How does site specific recombination differ from homologous recombination Answer : a. It requires a…
Q: To describe: The competitive and noncompetitive inhibitors and also describe the way in which they…
A: Inhibitors are molecules that prevent enzymes and substrates from binding together. Inhibitors work…
Q: To examine: Whether the statement, "If an oxidation occurs in a reaction, it must be accompanied by…
A: When an electron is removed in a chemical reaction, the state is known as oxidised, and when an…
Q: So if you see growth on a histidine-deficient medium in a yeast 1 hybrid and you assume that it is a…
A: The basic Y1H assay involves two components (Figure 2): 1) a reporter construct with DNA of interest…
Q: Which of the following statement is most correct about fevers? CH Fevers are never dangerous. Just…
A: Fever is the temporary increase of body temperature of 98.6 degree F. It is the part of body's…
Q: Compare the male and female reproductive organs of reptiles and birds. Explain how are their…
A: Introduction Reptiles are cold-blooded animals that have vertebral columns at their backs. These…
Q: scuss all the importance of epithelium found in the digestive tract.
A: The digestive system is a collection of organs that aid in the digestion of food materials and the…
Q: Q1/Answer the following: 1. Describe the digestion of proteins by pancreatic enzymes? 2. Write the…
A: 1) Pancreatic proteases: Trypsin and chymotrypsin are endopeptidase type of enzymes. They…
Q: Which of the following is FALSE? In vertebrate sensory neurons, nerve impulses normally travel one…
A: The false statement is, The resting potential of a neuron is maintained by membrane pumps…
Q: Occasionally, a person is found who has one blue eye and one brown eye or who has a sector of one…
A: Introduction A mutation is a change in an organism's DNA sequence. Mutations can be caused by…
Q: Supposing two strains of autotetraploid plants are available and their genotypes are as follows.…
A: Im answering only first part Answer :- We know that genotype contributes to phenotype. Genotype is…
Q: Which of the following is not a function of the lymph nodes? They supply lymphocytes for the body a.…
A: Lymph is the transparent colourless yellow tissue fluid that contains white blood cells…
Q: Bone tissue contains: O living cells O collagens fibers O calcium and phosphorus O all the above
A: Tissue is a group of cells which perform specific function. The tissue present in the bone is known…
Q: Describe how the environment has a significant impact in plant growth and development.
A: Plans require some environmental or external factors to synthesis food for their survival. These…
Q: The West Nile virus has what mode of transmission? a) Propagative b) Cyclo-propagative c)…
A: Answer- propagative
Q: effect of increasing nucleocytoplasmic ratio during cleavage formation?
A: Cleavage Cleavage is defined as the embryological cell division. The resulting cells after cleavage…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
What would happen if
The 5’ cap was missing on the mRNA transcript?
The lac repressor had a mutation and could not bind to the inducer lactose?
Sperm-producing cells in the testicles were exposed to nitrous acid?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- What would happen if the retinoblastoma protein wasn't able to bind to the E2F transcription factor?A cell inherits a mutation in a gene that results in a transcription factor, called NF-kB, constantly being in its active conformation. When active, NF-kB stimulates the expression of cyclins that promote progression of the cell cycle, regardless of other conditions. As a result of this mutation, how would this cell's phenotype be affected by this mutation? A) This cell would have a cancer phenotype B) This cell would grow larger in size, but would never divide C) This cell would likely undergo apoptosis D) This cell would not duplicate its chromosomes .You are studying the M-cyclin. You treat mitotic cells with an inhibitor of the proteasome and find that M-cyclin is no longer degraded and that this prolongs mitosis. You also find that in the presence of the inhibitor, M-cyclin is now running slower/larger in a Western than you have previously observed. In 1-2 sentences, explain why this might be happening. Edit View Insert Format Tools Table 12pt Paragraph B IU Αν S A C I AT²✓ #tv A MacBook Air X : G
- Give 4 examples of transcription factors / non-structural proteins you have learned in this course? Identify the most commonly used technique for diagnosing COVID-19? And the clinical sample for each technique. …….…… virus can cause encephalitis, cancer, sexually transmitted disease, infect external genitalia, mucosal surfaces, gladiatorum, and/or other diseases. How can the infection with this virus be avoided? Suggest two ways of prevention or to destroy the virus.Progesterone is a steroid hormone (also described as a ligand) that prepares the body for pregnancy. It binds to the progesterone receptor (PR) protein in the cytoplasm of various cells. Ligand bound PR acts as a transcriptional activator, binds to the DNA in the promoter region of several genes and leads to transcriptional activation of these genes. Which of the following statements must be true for the PR protein? O Ligand binding to the PR results in a conformational change in the primary structure of the protein The domain/region of the PR protein that interacts with the DNA, has basic amino acids Ligand binding to the PR results in a conformational change in the tertiary structure of the protein The domain/region of the PR protein that interacts with the DNA, has acidic amino acids(46) A mutated form of protein p5x is found in patients with squamous cell carcinoma. In vitro studies show that the normal p5x molecule binds to DNA, and neoplastic cells accumulate in the G0 phase of the cell cycle. In contrast, the mutated form of p5x does not bin d to DNA. These finding are most characteristics of which of the following? (A) Growht factor receptors (B) GTP-binding protein (C) Nonreceptor tyrosine kinases (D) Oncogene proteins (E) Tumor suppressor gene proteins
- (46) A mutated form of protein pox is found in patients with squamous cell carcinoma. In vitro studies show that the normal p5x molecule binds to DNA, and neoplastic cells accumulate in the G0 phase of the cell cycle. In contrast, the mutated form of p5x does not bind to DNA. These finding are most characteristics of which of the following? (A) Growht factor receptors (B) GTP-binding protein (C) Nonreceptor tyrosine kinases (D) Oncogene proteins (E) Tumor suppressor gene proteinsIf the lacl gene is mutated so that the repressor protein no longer binds to lactose, what will be the effect on the expression of B-galactosidase in lactose's presence and absence? Explain. If the promoter for lacl is mutated so that the expression of the repressor increases, what will be the effect on the expression of B-galactosidase in the presence and absence of lactose? Explain. D. (Extremely tricky question!) Describe the behavior of the lac operon assuming that the lacl gene has been mutated so that the repressor now binds to DNA in the presence of lactose but cannot bind to DNA in the absence of lactose.A woman has an egg with a mutation for the gene that expresses whether the child can produce lactase enzymes. Here is the new nucleotide sequence with the change in bold. 3’ – ACCTCTTACTTCTATATATAGGGAAGACTAATTGTC – 5’ what type of mutation is this? Will this affect the child's abilty to produce lactase enzymes needed to digest lactose?
- Some cancers are consistently associated with the deletion of a particularpart of a chromosome. Does the deleted region contain an oncogene or atumor-suppressor gene? Explain.The oncogenic protein BETA promotes entry into the S phase of the cell cycle. Phosphorylation of BETA at the amino acid Tyr98 causes BETA to be degraded by the proteasome, thus limiting its abundance. A mutation in the codon encoding Tyr98 changes this residue to Cys, which cannot be phosphorylated. What is the best description of this mutant allele?a) antimorphb) hypermorphc) hypomorphd) amorphe) neomorphIn humans, why is it that the mother transmits nearly all of the extranuclear genes to her children?