D. Fill in the table below. Determine the correct template and coding strands to properly answer this. _C_ __A T_C AT_ _GT DNA double helix T__ _T_ _CA mRNA __A AC_ GC_ __G_C___ tRNA anticodon GCA Polypeptide (Stop) Trp
Q: Your friend is convinced his calico cat is male. He takes the cat to the vet. Sure enough the cat is…
A: Introduction: The coat of calico cats is tricolour. They are females because their colouring is tied…
Q: Label the parts of the frog
A: Introduction A frog is any member of the order Anura, which consists of a diverse and primarily…
Q: The contractile unit of a muscle fiber is called: O myosin O actin sarcomere O sarcolemma
A: Introduction :- Muscle fibres are made up of just one muscle cell. They aid in the control of the…
Q: Please give me a discussion/explanation of (INVITRO STUDIES AND INVIVO STUDIES) part in drug…
A: In vivo studies allow the long-term effects of the drug to be monitored and observed as well as…
Q: rostaglandin-endoperoxide synthase 2, also known as cyclooxygenase- or COX-2, is an enzyme that in…
A: Prostaglandins directly act upon nerve endings to induce pain. They may also speed up the process of…
Q: Small molecules binding to histone proteins also control gene expression by chromatin remodelling…
A: Genes or DNA are generally coiled and held together by the help of structural proteins called…
Q: Give a major disadvantage of RAPD as a DNA marker. Provide one (1) recommendation on how to address…
A: Introduction RAPDs are random sequence DNA fragments generated by PCR using short synthetic primers…
Q: what is the placentation type (basal, apical, parietal, or marginal) of avocado? How many locules…
A: ANSWER;- Answer: Parietal Placentation Explanation: Placentation in the distribution of the placenta…
Q: The principal products of which RNA polymerases are exported from the nucleus by exportin? Pol II…
A: Introduction RNA polymerase is the main enzyme which is required in transcription process. In…
Q: why are underground storage organs like onions, carrots, cassava, potatoes, etc high in carbs and…
A: Underground storage organs (USOs) are an important food source for many people around the world.…
Q: There are many different sources of biomass and many ways of harnessing energy from biomass. Discuss…
A: Introduction The exponential rise in population and in increasing demand for food and fuel lead us…
Q: Study the diagram below to identify the pressure relationships which are present during VENTRICULAR…
A: During first part of ejection ventricular pressure rises blood is intensively ejected to the…
Q: How do advantageous traits lead to evolution? Put the steps in the proper order. advantageous trait…
A: Variation. Organisms (within populations) exhibit individual variation in appearance and behavior.…
Q: Make an introduction explaining the difference, importance, and factors of the gelatine gels and…
A: Agar or agar-agar, is a jelly-like substance consisting of polysaccharides obtained from the cell…
Q: In a population of 10000 people 49 have cystic fibrosis ( a genetic disorder). How many percent are…
A: A trait is a characteristic feature that is unique to particular individual . Inheritance pattern is…
Q: uman Body Systems Red blood cells carry oxygen to all cells in the body. Why is it important for all…
A: Cell is the building block of life. All organisms are made up of cells. These cells require oxygen…
Q: The diagram below shows the succession of communities from annual plants to hardwood trees in a…
A: The procedure of ecological succession suggests how the shape of an organic network (that is, an…
Q: List down at least five urinary/excretory diseases, their symptoms, and treatment
A: Introduction:- The excretory system is a vital biological component that keeps the human body in a…
Q: What are B and T cells and how do they relate to lymph nodes? 2. What are cell-surface antigens? How…
A: Introduction:- The remarkable specificity of adaptive immune responses is due to lymphocytes.…
Q: What are some of the applications of animal reproduction and development in the real world?
A: Animal reproduction & development is one of the important aspect of animal life. Every organism…
Q: Mutations caused by insertion of a DNA transposon are often genetically unstable, reverting to…
A: if a DNA transposon is inserted into DNA it causes mutations. these type of mutations are not…
Q: Glucose is required for aerobic cellular respiration.. False True
A: Aerobic cellular respiration occur in presence of oxygen in mitochondria. The first step occurs in…
Q: You would expect antibiotics to effectively treat: O A. Chickenpox virus O B. The flu O C. Common…
A: Introduction Infection:- It is the invasion and growth of germs in the body, The four main types of…
Q: A group of snakes were all placed into environments that had differing selective pressures. Read the…
A: Natural selection of a particular trait can take place in 3 ways; they are Directional selection :…
Q: Common Name: Rice Weevil Scientific Name: Sitophilus oryzae Host Range: _____________ Economic…
A: Introduction Rice Weevil:- Sitophilus Oryzae is also called Rice weevils, adults live 3 to 6 months,…
Q: Is it biologically possible for DNA to undergo replication in vivo, without the lagging and the…
A: Introduction When the DNA chromosome is replicated, two copies of each identical daughter cell are…
Q: QUESTION 9 In a lab, researchers induced a mutation to the Gal3 gene in yeast. The original sequence…
A: Abrupt changes in the DNA sequences are called mutations. these may or may not change the protein…
Q: is/are performed by consumers, and equation(s) is/are performed by producers. a. I; II b. II; I c. I…
A: All organisms on earth require input of energy from its environment. we know that son is the source…
Q: Which of the following is not a function of the lymph nodes? They supply lymphocytes for the body a.…
A: Lymph is the transparent colourless yellow tissue fluid that contains white blood cells…
Q: To examine: Whether the statement "Horizontal gene transfer is more prevalent in single-celled…
A: Cells make up all living organisms on the planet. "Life's structural and functional unit is defined…
Q: Summarize the bones of the bird skeleton and its structural parts. Table 1. Summary of Avian…
A: Aves Aves is a taxonomic class including birds. Birds evolved from reptiles, as the…
Q: +1 1 4 6. 7 8 9. Transcriptional stop sequence +1 ТАTA box ATG ТАА AUG UAA Here is a diagram of a…
A: A base pair is two nucleotides that together constitute DNA ladder." A DNA nucleotide is composed of…
Q: Name the airways in the mammalian lung. What are their functions? How does air enter and leave the…
A: In mammal the respiratory system exchanges gases with the surroundings. Once air enters through the…
Q: Which of the following fusion of molecules establishes the backbone of an amino acid? 1. An alpha…
A: Amino Acids are monomers of long protein chains. Two amino acids are connected by the peptide bonds…
Q: Question 13 Staphylococcus aureus toxin responsible for symptoms associated with food poisoning is…
A: Staphylococcus aureus is a Gram-positive round-shaped bacterium.
Q: Why do dieters who follow Atkin’s diet (a diet high in fat and protein and very low in carbohydrate)…
A: Atkins diet It is diet that involves the uptake of foods that are rich in proteins and fats and the…
Q: Describe in detail the importance of tje new informqtion that is being applied in South African…
A: SAMS is provided freely to all schools. The aims of this are to assist schools with their own school…
Q: advantages of using larger restriction fragments when constructing a genomic library of human DNA
A: DNA library A DNA library is a collection of cloned DNA fragments containing the gene of interest.…
Q: Gene flow can have one effect in the context of a single population, and a different effect in the…
A: Gene flow is the movement of genes or alleles between populations separated by geography. The…
Q: Discuss the mechanical and chemical digestion of starch, protein, and fat, describing all the steps…
A: Introduction Digestion is the breakdown of large water-insoluble food molecules into small…
Q: Which of the following is NOT a part of the axial skeleton? scapula sacrum O ribs O cranial bones
A: The skeletal system is responsible for providing the framework to the body. It is made up of bones.
Q: What is mitochondria
A: In this question we have to describe about one of the most important organel of our cell which is…
Q: Skeletal muscle contraction requires: O calcium ions O ATP O arrival of a nerve impulse all the…
A: Skeletal muscle is composed of muscle fibres which have smaller units called myofibrils. There are…
Q: What is molecular basis of muscle fatigue?
A: Introduction :- Muscle fatigue is a sign that your muscles' ability to perform is deteriorating with…
Q: Compare and contrast blood plasma, glomerular filtrate, and urine characteristics. Compare and…
A: Urinary system : There are two kidneys(excrete wastes) ,two ureters (transport urine from kidney…
Q: a. Use a labelled b. Explain how th operon?
A:
Q: Question 5 To identify genes associated with the movement disorder Parkinson's disease, you decide…
A: Inorder to amplify a double stranded DNA via PCR, we require 2 sets of primer; a forward primer and…
Q: Experiment 1: An RT-PCR was run on human cells growing in tissue culture under standard conditions,…
A: PCR - Polymerase chain reaction (abbreviated PCR) is a laboratory technique for rapidly producing…
Q: What is the importance of feedback systems in the control of hormonal output in mammals? Offer two…
A: A feedback mechanism is a loop in which a product feeds back to control its own production.
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Step by step
Solved in 2 steps with 1 images
- Analysis of a mRNA sample showed that 18% of the nitrogen-base molecules present were uracil molecules. The DNA molecule that was transcribed to form the mRNA sample would most likely contain Select one: a. 18% adenine b. 18% cytosine c. 32% thymine d. 32% adenine O O OUse a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…C. Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence in the anticodons of tRNA, determine the appropriate Amino acid sequence that will be synthesized. Refer to the genetic code. 1. DNA Template: TAC - GGC - TAC - CAT - ATG - GAG mrNA: tRNA: Amino acid sequence: 2. DNA Template: TTA - CAT - CAT - ATC - GAT - GAC mrNA: tRNA: Amino acid sequence: 3. DNA Template: CTA - GCG - ATA - AAA - TTT - ATT mrNA: tRNA: Amino acid sequence:
- For each mutant, state what change has occurred in the DNA, whether it was a substitution by transition or transversion, sense mutation, nonsense or reading frame change. It must present the codon sequence. Normal nucleotide sequence starting from the third codon: CCC-ACG-GUG-ACG-ACA-CGG-UGG Please show the codon and nucleotide sequence of the mutation.Using a codon table, complete the DNA triplets, mRNA codons, tRNA anticodons, and amino acids in the table below. DNA triplet mRNA codon tRNA anticodon Amino Acid AAG GGC CAG UUA AAA GTA CUC ACA TAT AGC AUU CCA GGChe sequence is read from left to right. The table below shows which mRNA codons code for each type of amino acid. UUA - Leu | UCA - Ser UAA - Stop | UGA-Stop UUU - Phe | UCU - Ser UAU- Tyr UGU- Cys CỦA - Leu CCA - Pro CAA - Gln | CGA - ArgA UUG - Leu UCG - Ser| UAG-Stop UGG- TrpG A DNA sequence before and after replication IS SHO Second mRNA base G DNA sequence before replication: UUC - Phe UCC -Ser UAC U TACCTAGCT Туг UGC Cys DNA sequence after replication: A TACCTCGCT Leu CCU - Pro CAU - His CGU. CUU Arg U - Pro CAC - His CGC- ArgC CUC - Leu ССС Pro CAG - Gln | CGG - Arg G CUG - Leu CCG Thr AAU - Asn AGU - Ser Ile ACC - Thr AAC- Asn AGC Ile ACU AUU AUC Ser Lys AGA Arg Thr AAG - Lys AGG - AUA Ile ACA - Thr AAA- A mutation occurred in the DNA sequence during replication. Which of the following, A-D, Arg Asp GGU-Gly AUG - Met ACG GUU - Val GCU - Ala GAU - GỤC - Val GCC - Ala GAC - Asp GGC - Gly Val GCA -Ala GAA - Glu GGA - Gly Val GCG - Ala GAG-Glu GGG-Glv describes the result of the…
- CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT TAG TCG ATT ACC CGT TTA TGT TAA TTA CCT ATC 1. Build the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly letter by letter. (assume that the mRNA is bacterial there are not intros to cut out) 2. Figure out the tRNA triplet (codons) that would fit the mRNA triplets. (letter by letter) 3. Look up for each tRNA codon and find the corresponding symbol and amino acid abbreviations. The symbols should spell out a meaningful English message.CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT TAG TCG ATT ACC CGT TTA TGT TAA TTA CCT ATC 2. Figure out the tRNA triplet (codons) that would fit the mRNA triplets. (letter by letter)CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT TAG TCG ATT ACC CGT TTA TGT TAA TTA CCT ATC 1. Build the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly letter by letter. (assume that the mRNA is bacterial there are not intros to cut out)
- B. One strand of a section of DNA isolated from E. coli reads: (Assume no start codon is required as is true under certain test tube conditions). 5' GTAGCCTACCCATAGG 3' What is the complementary DNA strand? 2. Suppose mRNA is transcribed from this DNA using the complementary strand as a template. What will be the sequence of the mRNA? 3. What would be the corresponding anticodons? 4. What peptide would be made if translation started exactly at the 5' end of this mRNA?Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.From the mRNA base sequence CUU-AUG-GCU-UGG-CCC-UAA A.What anticodon sequences of tRNA’s are coded? B.What was the base sequence in the original DNA strand was made? Please answer completely will give rating surely Both questions answers needed