What is the composition of minimal initiation complex during transcription? TBP, TAF, TFIIA, TFIIB, TFIIF O TFIIA, TFIIB, TFIIF, RNA Pol II TEIID, TFIIA, TEIIB, TFIIF TEIID, TFIIA, TEIIB, TFIIF, RNA Pol II
Q: 5. Since in this patient pyruvate kinase is abnormal not only is less pyruvate made but…
A: Pyruvate kinase is an glycolytic enzyme, which catalyzes the conversion of phosphoenolpyruvate (PEP)…
Q: di-deoxy nucleotides terminate DNA elongation in Maxam-gilbert method. True False
A: First-generation DNA sequencing methods include Maxam–Gilbert sequencing and the Sanger method.…
Q: What are massive, insoluble, high molecular weight compounds that have brown color? Not…
A: The brown pigment observed in different foods such as cookies, breads etc is the result of a…
Q: Morphine (give structure) and en receptor. How is that possible?
A: Antagonist are the drugs that plays an important role in blocking opiods without activating them by…
Q: 1. If the Km of an enzyme for substrate A is 1 x 106 and for substrate B, is 4 x 10°, it means a.…
A: The Michaelis constant, Km, varies considerably from one enzyme to another, and also with different…
Q: 3. Draw the chemical structure of cholesterol and state its functions 4. Explain in detail the…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: A glycogen polymer and an amylopectin polymer, each containing 100 monosaccharide subunits, are…
A: Amylopectin and glucogen are examples of branched polysaccharides.
Q: alculate the free energy change for glucose entry into cells when the extracellular concentration is…
A: An amount of energy is released in the conversion of reactants to products under standard conditions…
Q: HN- CH H2N-CH-c-OH HaN — сн—с— он | Н-N— сн—с—он CH2 CH2 ČH2 CH2 CH2 CH2 NH2 ÓH A B D H2N-CH-C. -ОН…
A: Aminoacids are the building blocks of proteins. They have two functional groups along with side…
Q: Some protein kinases are inactive unless they are phosphorylated on key serine or threonine…
A: The activity of many proteins are modulated by post-translational modification of the proteins.
Q: why all amino acids except glycine have L and D forms and specify the type of isomerization…
A: Amino acids are the monomeric units of proteins. The general structure of an amino acid has a…
Q: Procedure: 1. Dissolve one teaspoon or one packet of active yeast in a small amount of warm water.…
A: Hi, thanks a lot for submitting multiple questions and as you have asked to answer 5, 6 and 7…
Q: 2. Which of the following is not a type of specificity?
A: If we talk about specificity there is many feilds where the specificity is play there role and all…
Q: Using punnet square, determine the chances of an autosomal recessive trait produced from the cross…
A: The Punnett square is used for the determination of genotype. Punnett square is a square diagram in…
Q: (8) B-ketothiolase is a multifunctional enzyme in lipid catabolism. Which of the following is NOT…
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…
Q: Classify the following amino acids base on their side chain if it's either -Non-polar aliphatic R…
A: Amino acids are the molecules that contain an amino group and a carboxylic group linked through the…
Q: importance of nutrition
A: Nutrition is the biochemical process by which an organism eats a healthy and balanced diet through…
Q: 3. (а) 0.0050 M operate at one-quarter of its maximum rate? At what substrate concentration would an…
A: To study an enzyme kinetics, Michaelis-Menten kinetics equation is best known mathematical…
Q: Match the non-Mendelian genetic terms with their descriptor. Genetic and environmental factors…
A: Genetic and environmental factors collectively influence a phenotypic expression Answer-…
Q: mg/L of cell tissue and 10 mg/L of ammonia
A: TKN is refers to the term Total Kjeldahl Nitrogen which is defined as the total concentration of…
Q: Patient who had undergone a complex maxillofacial operation could not take food during 2 days, but…
A: Introduction: The level of blood glucose monitoring gives us insight into the effectiveness of the…
Q: . ) In one (1) sentence point out a key structural similarity and difference in each of the…
A: Nucleic acids are constituted of nucleotides linked via phosphodiester linkages while proteins are…
Q: Calculate the overall ΔG° (report up to two decimal places) for the net reaction (see attached…
A: Standard free energy change is the Gibb's free energy at 273k temperature and 1 atm pressure ∆G°=…
Q: A buffer can protect against changes in pH when hydrogen ion or hydroxide ion is added to a reaction…
A: Buffer solution is two types, Acidic buffer - this is composed of a weak acid and it's conjugate…
Q: RNA DNA Strand Sugar residue Nitrogenous bases Main Function
A: Deoxyribonucleic acid (DNA) and Ribonucleic acid (RNA) are the two types of nucleic acids that…
Q: In the majority of cases, amino acid catabolism can be broken down into a two-step process;…
A: The catabolism of the amino acids begins with the removal of the amino group. The amino group can be…
Q: How are the organelles in a cell similar to the organs in a human body? Explain in 3-5 sentences.
A: Organelles are cellular components, which perform specific functions inside the cell. Different…
Q: . Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC…
A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…
Q: Enzymes accelerate the rate of a reaction by: a. lowering the number of molecules with lower…
A: Introduction: Enzymes are biological catalysts that fasten the speed of the chemical reaction. They…
Q: Prepare a concept map connecting carbohydrate and lipid synthesis. Your map should include shared…
A: Carbohydrate metabolism : Carbohydrates are the most abundant molecule defined as a poly hydroxy…
Q: Why are they so designated? Ketone bodies are so named because they contain the ketone functional…
A: Ketone bodies are produced by the liver during caloric restriction.
Q: You are supplied with an unknown protein that consists of more than 130 amino acids. Furthermore…
A: Proteins are the most abundant biomolecule constitutes nearly 75% of the total body weight. Proteins…
Q: Which steps below require an ATP to run?
A: ATP is an energy currency for several biochemical steps in the living organism. It is composed of…
Q: Which among the following statements is correct? Negatively-charged proteins are eluted out first…
A: Affinity chromatography is an analytical method for separating biomolecules in a mixture, based on…
Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: The Human genome project used the following methods Shotgun Sanger Both None
A: The Human Genome Project : It was an international effort to find the DNA sequence of the complete…
Q: Why most of the clinical features of the diseases Krebs Cycle inborn errors ( a- ketoglutarate…
A: Krebs cycle : This pathway plays an important role in the living cell metabolism also known as…
Q: During asexual reproduction, the zygote develops into an embryo which turns to be an identical copy…
A: Asexual reproduction is the process of producing identical daughter cells without fusion of gamets.…
Q: Consider the Michaelis-Menten equation, below: Vmar S V. k + [S] %3D What is the relationship…
A: [S] : Substrate concentration V= Vmax[S]/(Km+[S]) Vmax: Maximum velocity Km: [S] at which V is…
Q: 5. Compare and constrast the energy content of fats, carbohydrates and proteins.
A: Carbohydrates, proteins and fats are three major form of biomolecules found in living beings. These…
Q: How many types of histone proteins are present in eukaryotic chromatin? 3
A: In the nucleus of eukaryotic cells, histones are highly basic proteins with a lot of lysine and…
Q: DNA scissors used in genetic engineering applications are called Endo nucleases Restriction enzymes…
A:
Q: What is cryopreservation? How do we reduce the risk of cell damage from osmolytic pressure in…
A: Cryopreservation is primarily used to preserve biological specimens. Individual cells and biological…
Q: Why picric and tannic acid is used for the treatments of burn. Explain this in the concept of…
A: Tannic acid and picric acids are phenolic compounds. These are water-soluble compounds…
Q: How does NH4SO4 affect water structure? What does this have to do with protein solubility? I thought…
A: One of the factors that determine the solubility of proteins in solution is the concentration of…
Q: HN- CH- OH HN-CH-c- -OH HN-CH-C-OH CH CH2 CH2 CH2 OH C= NH2 OH A B D C.
A: Amino acids are those molecules which combine to form particular proteins. Amino acids and proteins…
Q: 1. List several methods (other than Bleeding Time -Ivy method, Capillary Tube Method, Lee and White…
A: Introduction: Bleeding time: It is the time interval between the skin puncture and spontaneous,…
Q: Question 8 Which of the following IS a Phase Il metabolic reaction? O Fornation of a ketone at a…
A: Question 8 ans: Phase l metabolism is when a parent drug is converted to polar active mrtabolite…
Q: rue or False? a. Ribose and deoxyribose are formed from glucose.
A: Ribose is a pentose sugar with molecular formula C₅H₁₀O₅, it is the prime component of…
Q: The DNA and associated proteins of a eukaryotic chromosome are called Chromatin Chromatosome…
A: Eukaryotic chromosomes are made up of DNA that is tightly coiled around histone protein clusters.…
Step by step
Solved in 2 steps
- The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the bottom strand is template, which of the following RNA sequences would be transcribed? DNA: 5-'ATAGGCGATGCCA-3' 3'-TATCCGCTACGGT-5' O 5'-UAUCCGCUACGGU-3' O 5'-ACCGUAGCGGAUA-3' O 5'-AUAGGCGAUGCCA-3' O 5'-UGGCAUCGCCUAU-3'Which of the following is/are true regarding transcription initiation in bacteria? TFIID will bind the promoter at the -10 and -35 consensus sequences, then it recruits RNA polymerase Il to initiate transcription. RNA polymerase core enzyme binds the promoter at the -10 and -35 consensus sequences, then initiates transcription with the help of the sigma subunit. TFIID binds the promoter at the TATA box, then recruits RNA pol Il to initiate transcription. The sigma subunit protein of the RNA polymerase holoenzyme binds the promöter at the -10 and -35 consensus sequences, then the holoenzyme unwinds the DNA and initiates RNA Svethocie Bacteria are only able to initiate transcription of genes when ribosomes are available. Ov.The sigma-70 promoter is very well-studied. The Sigma-54 promoter, on the other hand, hasn't had quite as much study devoted to it, but a consensus sequence for Sigma-54 promoters has been determined, and it looks like this: C GAAA FICGCACTECT УА C 5-26-25-24 -23 -22 -21 -20 -19 -18 -17 -16-15-14-13-12-11 -10 3 wablogo berkalay.edu (From Franke et. Al, 2011 BMC Genomics) If you were studying a gene with a promoter that exactly matched the consensus sequence, which base would, if mutated, probably make the largest difference in the ability of Sigma-54 to bind to a promoter? O Base position 26 Base position 10 Base position 12 Base position 16
- TAN TTGC IGGAG Nanog regulatory sequence Given this interaction map which DNA sequence would the transcription factor most likely bind to? CAAGGAG ATTAACG TAATTGG TAATTGCIn which strand is the promoter? 5' TCATGAGATA GCCATGCATA TCTAGTATGT AGGCATCTGA GTTTATATCT CA 3’ 3' AGTACTCTAT CGGTACGTAT AGATCTATCA TCCGTAGACT CAAATATAGA GT 5'During the process of bacterial transcription initiation, an open complex is formed involving the promoter and RNA polymerase. The open complex ________________________________. is the first complex formed between RNA polymerase and the promoter is formed after the sigma factor is released is an unstable transcription initiation complex formed between RNA polymerase and the promoter in the absence of sigma factor is a transcription complex in which an RNA stem-loop structure keeps the DNA strands separated. is a stable transcription initiation complex in which the DNA strands in the promoter region are separated
- Which of the following is a property or characteristic of eukaryotic promoters? They contain the -10 and-35 consensus sequences where RNA polymerase holoenzyme, containing the sigma factor, bind to initiate transcription. | They contain the -10 and -35 consensus sequences that are the site where general transcription factors bind to help RNA polymerase holoenzyme initiate transcription. They contain a TATA box to which sigma factors bind to help RNA polymerase core enzyme initiate transcription. O I. They are usually located far away from the gene that is being transcribed. IV. OV. A, They are bound by general transcription factors, which help RNA polymerase I, II, or III, bind to the promoter and initiate transcription.During eukaryote transcription initiation, when TFIIE, TFIIA, TFIIB, TFIIF, and RNA pol II all join on the DNA strand, how do they know where to be put on the strand?Why is an NFR needed at the core promoter for transcription to occur?
- Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'A pre-initation complex (PIC) is required for transcription to begin. State which TFII protein has catalytic function.How does the 4 feature of transcription factors namely the structural motifs of DNA binding protein, activation domains, multiple transcription factors and enhancers help in the design of a building block tool. U can use the SrY gene as ur building block tool. Pls explain in details using those features of the transcription factors. In 400 words