Please answer the question attached thank you 3a. The deletion found in Bace2 is in Exon 1, and codes for a prematurestop codon.Chr1Bace2180 180Exon 1Exon 3Exon 5Exon 7Exon 9Exon 2Exon 4Exon 6Exon 8176CTGGCGCTCGCCCTGCTGGCGC25 bpdeletionThis means that brown bears have:200GCGGC GCCGCC269ATGCTGATCCGCCATGCTGATCPrematurestop codonshorter mRNA than black bearsno transcription of exons after Exon 1fewer amino acids made during translationno chromosome 13b.If the deletion had been a 24 bp deletion, do you think that thebrown bear phenotype would exist? Why or why not (choose thebest answer)?Yes this deletion is in an exon, it was always going to changethe phenotypeYes this deletion is in the first exon, it was always going to-change the phenotypeNo, 25 bp deletion led to a frameshift, 24 would not haveresulted in a frame shiftNo, a 24 bp would have led to allelic haplosufficency

Name: Please answer the question attached thank you 3a. The deletion found i
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Please answer the question attached thank you 3a. The deletion found in Bace2 is in Exon 1, and codes for a prematurestop codon.Chr1Bace2180 180Exon 1Exon 3Exon 5Exon 7Exon 9Exon 2Exon 4Exon 6Exon 8176CTGGCGCTCGCCCTGCTGGCGC25 bpdeletionThis means tha

Nucleotides in DNA are arranged in exons or introns. Exons are the coding sequence whereas introns…

Answered: stop codon. C Chr1 Bace2 180 180 Exon 1…

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Concept explainers

Topic Video

Question

Please answer the question attached

thank you

3a. The deletion found in Bace2 is in Exon 1, and codes for a premature
stop codon.
Chr1
Bace2
180 180
Exon 1
Exon 3
Exon 5
Exon 7
Exon 9
Exon 2
Exon 4
Exon 6
Exon 8
176
CTGGCGCTCGCCCTG
CTGGCGC
25 bp
deletion
This means that brown bears have:
200
GCGGC GCCGCC
269
ATGCTGATC
CGCC
ATGCTGATC
Premature
stop codon
shorter mRNA than black bears
no transcription of exons after Exon 1
fewer amino acids made during translation
no chromosome 1
3b.
If the deletion had been a 24 bp deletion, do you think that the
brown bear phenotype would exist? Why or why not (choose the
best answer)?
Yes this deletion is in an exon, it was always going to change
the phenotype
Yes this deletion is in the first exon, it was always going to
-
change the phenotype
No, 25 bp deletion led to a frameshift, 24 would not have
resulted in a frame shift
No, a 24 bp would have led to allelic haplosufficency

Expert Solution

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Recommended textbooks for you

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON