MatingSte12Tec1Budding17. (8 points) Scientists are studying the transcription factorsSte12 and Tec1. They have found that when ste12 binds toone part of the genome alone it activates the transcriptionof genes important in mating pheromones. They also foundthat when Tec1 binds to another part of the genome aloneit activates the transcription of cellular budding genes.Lastly, they found that in another part of the genome,Ste12 and Tec1 both bind to the DNA, they activate thetranscription of genes that control the formation of filaments.a) These proteins bind to enhancers. Is Ste12 and Tec1 activators or mediators? How doyou know?Filamentationb) Is this system an example of combinatorial control or coordinated control, both orneither? Explain your answer.sold ad bosow

Combinatorial control is a regulatory mechanism in gene expression where multiple transcription…

Answered: Mating Ste12 Tec1 Budding 17. (8…

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 14RQ: A scientist compares the promoter regions of two genes. Gene A’s core promoter plus proximal...

See similar textbooks

Similar questions

GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
I. The retinoic acid receptor (RAR) is a transcription factor that is similar to steroid hormone receptors. Thesubstance (ligand) that binds to this receptor is retinoicacid. One of the genes whose transcription is activatedby retinoic acid binding to the receptor is myoD. Thediagram that follows shows a schematic view of theRAR proteins produced by genes into which one oftwo different 12-base double-stranded oligonucleotides had been inserted in the ORF. The insertion site(a–m) associated with each mutant protein is indicatedwith the appropriate letter on the polypeptide map.For constructs encoding proteins a–e, oligonucleotide 1(5′ TTAATTAATTAA 3′ read off either strand) wasinserted into the RAR gene. For constructs encoding proteins f–m, oligonucleotide 2 (5′ CCGGCCGGCCGG 3′)was inserted into the gene.NH2 f g h i j k l m COOHa b c d eThe wild-type RAR protein can both bind DNA and activate transcription weakly in the absence of retinoic acid(RA) and strongly in RA’s presence. Each…
A scientist compares the promoter regions of two genes. Gene A’s core promoter plus proximal promoter elements encompasses 70bp. Gene B’s core promoter plus proximal promoter elements encompasses 250bp. Which of the scientist’s hypotheses is most likely to be correct? More transcripts will be made from Gene B Transcription of Gene A involves fewer transcription factors Enhancers control Gene B’s transcription Transcription of Gene A is more controlled than transcription of Gene B.
The a/a operon is an inducible operon that controls the production of the sugar arabinose. When arabinose is present in a bacterium it binds to the protein AraC, and the complex binds to the initiator site to promote transcription. In this scenario, AraC is a(n). activator inducer repressor operator
Discuss Concepts In a mutant strain of E. coli, the CAP protein is unable to combine with its target region of the lac operon. How would you expect the mutation to affect transcription when cells of this strain are subjected to the following conditions? Lactose and glucose are both available. Lactose is available but glucose is not. Both lactose and glucose are unavailable.
. Let’s say that you have incredible skill and can isolate the white and red patches of tissue from the Drosophila eyes shown in Figure 12-24 in order to isolate mRNA from each tissue preparation. Using your knowledge of DNA techniques from Chapter 10, design an experiment that would allow you to determine whether RNA is transcribed from the white gene in the red tissue or the whitetissue or both. If you need it, you have access to radioactive white-gene DNA
The enormous complexity in initiating eukaryotic gene transcription seems at first glance to be wasteful. What is the most plausible reason for requiring so many different proteins to assemble on a large array of DNA sequences in order to initiate transcription? O The use of large numbers of proteins and regulatory sequences in DNA opens many possibilities for sophisticated combinatorial gene regulation O The need to open chromatin for transcription demands a much larger number of proteins and regulatory sequences in DNA O The use of large numbers of proteins and regulatory sequences in DNA is essential for alternative splicing of hnRNA in eukaryotes O The larger number of eukaryotic genes demands a correspondingly larger transcription apparatus than that of prokaryotes The larger size of eukaryotic cells demands a correspondingly larger transcription apparatus than that of prokaryotes
The following double-stranded DNA sequence is part of a hypothetical yeast genome which contains a very small gene. Transcription starts at the Transcription Start Site (TSS), proceeds in the direction of the arrow and stops at the end of the Transcription Terminator (green box). 5' 3' TSS CTATAAAAATGCCATGCATTATCTAGATAGTAGGCTCTGAGAAATTTATCTCACT | | | | | | | | | | GATATTTTTACGGTACGTAATAGATCTATCATCCGAGACTCTTTAAATAGAGTGA - 5' PROMOTER TERMINATOR 3' a) Which strand (top or bottom) is the template strand? Explain why. b) What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends. c) What is the sequence of the protein produced from the mRNA? d) If a mutation (an insertion) were found where a T/A (top/bottom) base pair were added immediately after the T/A base pair shown in red, what would be the sequence of the mRNA? What would be the sequence of the protein?
a. Very few if any eukaryotic genes contain tractswith more than 25 As or Ts in a row, yet almost alleukaryotic mRNAs have a tract with more than100 As in a row. How is this possible?b. Scientists know the nucleotide sequences that directthe termination of bacterial gene transcription, butthey generally have little idea about the nature ofthe nucleotide sequences that direct transcriptiontermination in eukaryotic cells. Explain the basisof this statement.
Each year in the United States, there are over 230,000 newcases of prostate cancer and almost 28,000 deaths. A 3.8-Mbregion on chromosome 8 (8q24), called a gene desert, has genes but contains enhancer sequences that potentiallyconfer significant risks for prostate cancer. One particular enhancerallele, which is known to be associated with an elevated risk forprostate cancer, physically interacts with the promoter region ofthe nearby MYC gene and facilitates its upregulation. Overexpressionof MYC, which encodes a cell-cycle regulatory protein, isobserved in multiple types of cancer (see Chapter 24). The riskallele has a frequency of 49 percent in men of European descentand 81 percent in men of African ancestry. Most of the differentialMYC activity associated with the risk allele occurs during prenataldevelopment, raising the possibility that testing for this alleleearly in life can be used to identify those in the African-Americanpopulation who are at very high risk for prostate…
Q1. (Shown below is the structure of a Drosophila gene, divided into 10 segments, designated A-J. The gene contains three exons, two introns, a promoter, and a site in I for poly(A) addition. Exon 1 Exon 2 Exon 3 Promoter Intron 1 Intron 2 AATAA A в CDE FG|H a) What segment or segments of the gene will be represented in the initial RNA transcript (primary RNA)? List the appropriate letter or letters. b) What segment or segments of the gene will be found in the completely processed transcript (mature RNA)? c) What segment or segments of the gene in the processed transcript will have additional nucleotides added to them? d) If the segment... . is methylated, this could block the transcription's initiation as RNA polymerase will not be able to bind to this segment.
94In the arrested state (7-14 nucleotides) of elongation, ( ) is required to reactivate transcription. 95C. elegans has about 19,000 genes, a significant number of which are organized into operons. Yesorno 96Transcription activator proteins have at least two independently folding domains: 1. DNA binding domain and 2.

SEE MORE QUESTIONS

Recommended textbooks for you

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS