E2F is a transcriptiion factor that activates genes for DNA rep- proteins. In addition with RBR, E2F is one of the controls for G1 to S transition. Why would E2F have a role in totipotyency of plant cells?
Q: Which of the following contributed to mass extinctions? a. climate change b. continental drift c.…
A: Mass extinctions are the unexpected and widespread loss of biodiversity. These events have…
Q: answer only question g
A: Step 1:The anticodon sequence will be…
Q: A country that sees most Hepatitis B (HBV) infections in young adults is most likely to have what…
A: The correct answer is D. High endemicity. Hepatitis B virus (HBV) infections that occur…
Q: Describe the descovery of polymerase chain reaction (PCR), the components of the reaction and the…
A: The polymerase chain reaction, sometimes known as PCR, is a potent method in the field of molecular…
Q: G10
A: The question is asking to determine the number of exons in a gene if it is known that the gene has…
Q: Explain how the ATP pathway is similar to a rechargeable battery
A: Adenosine triphosphate or ATP is the energy currency of the cell. It is composed of three phosphate…
Q: What prevents overinflation of the lungs? partial pressure of oxygen in alveoli…
A: The question is asking about the mechanism that prevents the lungs from overinflating, which could…
Q: GQ Eight
A: Approach to solving the question:To identify the mutations in the Mc1r gene of the rock pocket mouse…
Q: DNA cloning refers to a. making cloned bacteria. b. making cloned sheep or other eukaryotic…
A: Sure! DNA cloning involves the creation of exact copies of a particular DNA fragment or sequence.…
Q: Microarrays a. must be preceded by a sothern blot b. compare gene expression levels across many…
A: Here's why the other options are incorrect:a. must be preceded by a southern blot: Southern blots…
Q: Define about Whole-Exome Sequencing ?
A: Whole- exome sequencing( WES) is a genomic approach for sequencing all of the protein- encoding…
Q: • What stage of translation is shown? elongation Which position shows the "A" position? middle…
A: This is the concept of molecular biology and the topic is TranslationTranslation is the process in…
Q: 1) Enter a number without the word "tree". ________ 2) Determine the proper numerical value for…
A: To determine the phylogenetic tree using the UPGMA procedure, we need to follow these steps: Step 1:…
Q: Genetics Q9
A: The question is asking us to identify the correct definition of a plasmid from the given options.
Q: In what stage of mitosis is the cell labeled "A"? A shutterstock B www.shutterstock.com 159810452 O…
A: During metaphase, which is a crucial stage of mitosis, the cell undergoes several key events as it…
Q: The most common type of leukemia is: Question 8 options: A) CML.…
A: The question is asking us to identify the most common type of leukemia. Leukemia is a type of cancer…
Q: Have you ever taken an online class? If so, describe one thing that the professor could have done…
A: My approach is personal but still generalized. You may modify whatever you see fit.
Q: The Greek anatomist Erasistratus, originally from Ceos, identified the correct function of the right…
A: The objective of the question is to identify the correct function of the right atrioventricular…
Q: Which blood product is used in the treatment of DIC? Question 9 options: a)…
A: The question is asking about the appropriate blood product used in the treatment of Disseminated…
Q: Need help with evolutionary biology problem
A: self-explanatory please give me a helpful rating if you are satisfied with the answer
Q: How many molecules of Glucose-1 - phosphate can be generated from this molecule?
A: Ten molecules of Glucose-1-phosphate can be generated from this molecule. Each distinct structure in…
Q: 16) Bacterial DNA replication is said to be: a) Linear b) curvilinear c) circular d) exponential e)…
A: 16) Bacterial DNA replication is said to be circular. This is because bacterial DNA is organized in…
Q: Proto-oncogenes can change into oncogenes that cause cancer. Which of the following best explains…
A: Cancer is caused by abnormal cell growth causing the formation of tumors. Tumor is a mass of cells…
Q: When researchers first discovered that airflow through a bird’s paleopulmonal parabronchi is…
A: The respiratory framework of birds highlights a one of a kind instrument for gas exchange, distinct…
Q: 18
A: DNA sequence 5'ACCTGTGCAATATACGGCCAT3'3'TGGACACGTTATATGCCGGTA5'mRNA5' ACCUGUGCAAUAUACGGCCAU 3'Amino…
Q: I am a second-year computer science major. I decided to take this course because I am currently in…
A: Let's break down how the provided answer comprehensively addresses the question: Acknowledgment of…
Q: Genetics Q9
A: The objective of the question is to identify the type of mutation that occurs when a DNA sequence…
Q: How would most biologists and anthropologists explain the reasons behind why primates do specific…
A: Primate behavior is generally understood by scientists and anthropologists to be the consequence of…
Q: What differences do you notice between the male and female forms of extant apes?
A: Extant apes are the apes that are still alive today. There are six extant ape species: gorillas,…
Q: For Electron Transport Chain (ETC), what are steps of cellular respiration for both aerobic (oxygen…
A: Approach to Solving the Question: Electron Transport Chain (ETC)This question focuses on the…
Q: i just want an answer to question g please make sure it's correct.
A: The DNA nucleotide sequence provided in the image is the template for synthesizing a protein. To…
Q: Which of the following would tend to DECREASE uptake of water by a plant root hair? Increasing the…
A: The question is asking which of the given options would decrease the uptake of water by a plant root…
Q: CRISPR is a powerful gene editing tool because a. the programmable enzyme (Cas9) can find an exact…
A: CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) technology has revolutionized the…
Q: All of the following are TRUE of a vertebrate whose blood flows directly from the respiratory organs…
A: The question is asking us to identify the incorrect statement about a vertebrate whose blood flows…
Q: In which direction would an MRI scanner move to produce sequential images of the body in the frontal…
A: The MRI (Magnetic Resonance Imaging) scanning refers to an apparatus, wherein the magnetic fields…
Q: A large protected area is set aside to aid in the maintenance of an endangered cheetah population.…
A: National parks, wildlife sanctuaries, biosphere reserves, reserved and protected forests, communal…
Q: Please explain
A: Lane A:* DNA sample: Human genomic DNA* Enzyme: EcoRI (5' G^AATTC 3')Lane B:* DNA sample:…
Q: Using proper convention, provide the amino acid sequence for the following peptide.
A: To provide the amino acid sequence for the given peptide, let's break down the structure into its…
Q: Phytoremediation is the utilization of plants in the clean up of a polluted area. In a maximum of…
A: Phytoremediation is a cost-effective and environmentally friendly approach to addressing soil and…
Q: Question 7 Take Quiz Exit 0.5 pts The only force of evolution that adds new gene variants to the…
A: Question 7The correct answer is A. Mutation.Explanation:Mutation: Mutation is the only force of…
Q: What is the procedure of enzyme formation in our body ? Explain it by drawing.
A: Enzymes are extraordinary chemicals that speed up responses in living things. They are critical for…
Q: What would the chromosome on the picture below look like after DNA replication?
A: During DNA replication, the chromosome undergoes a process where the DNA molecule is duplicated. As…
Q: After watching video that’s linked please answer the questions! Thank you!…
A: In diabetes, the body faces difficulties in regulating blood sugar levels due to problems with…
Q: 24
A: The diagram shows alternative splicing, a process where a single pre-mRNA molecule can be spliced in…
Q: Welcome Biological Anthropology LabMore specifically, tell us which topic you are the most excited…
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: GQ6
A: Approach to solving the question:Comprehending the variances in hair, skin, and eye color is…
Q: Would breathing pure oxygen cause a large increase in oxygen transport by the blood in a healthy…
A: Inhaling pure oxygen can influence a person's body in several ways depending on their overall health…
Q: 32. The antimetabolites inhibit: a) the ribosome assembly b) the ribosome movement c) cell…
A: Certainly! Let's delve into the details of how antimetabolites inhibit glycolysis and the Krebs…
Q: Sugar fermentation (Mannitol): 1. Explain the incubation conditions 2. Explain the reagents being…
A: Sugar fermentation, such as Mannitol fermentation, is a process where microorganisms, such as…
Q: < 11:22 My Files Lecture13Activities U.pdf Superior vena cava Activity 2 Sheep Heart Dissection…
A: Picture 1 Labelling Picture 2 Labelling
E2F is a transcriptiion factor that activates genes for DNA rep- proteins. In addition with RBR, E2F is one of the controls for G1 to S transition. Why would E2F have a role in totipotyency of plant cells?
Step by step
Solved in 3 steps
- After a cell "clears" the G₁ restriction checkpoint, it can proceed into S phase. This S phase entry is achieved by a cyclin dependent kinase (Cdk2) and its cyclin (Cyclin E), but additionally requires the action of a protein kinase (CDC2) as well as a phosphatase (CDC25) enzyme. Explain how these 4 proteins work together to orchestrate S phase entry.You are growing up myoblasts C2C12 cells,to use in a myogenic study,You are using T-150 flasks with a culture area of 150 cm2 and when confluent contains 2*107 cells. you seed a culture at 8 am on Monday with 5*105 cells .Assume all survive a generation time of 18 hrs and all cells are actively dividing.when will you expect them to be confluent?Notch signaling orchestrates transition from G1 to S phase of cell cycle by multiple other interactions that target the G1/S checkpoint machinery. This is a highly conserved pathway that is seen across multiple kingdoms of life and the ligands involved in notch signaling are typically membrane-bound proteins. This suggests that: -This pathway relies on hormone interactions via endocrine pathways -This pathway relies on signal propagation via paracrine molecules -This pathway relies on direct signaling across gap junctions -This pathway relies on cell binding via autocrine signaling
- You are growing up myoblasts, C2C12 cells, to use in a myogenic study. You are using T-150 flasks with a culture area of 150 cm^2 and when confluent contains 2 x 10^7 cells. Question: You seed a culture at 8 am on Monday with 5 x 10^5 cells. Assume all survive, a generation time of 18 hours and all cells are actively dividing. When would you expect them to be confluent? A) 7:24 AM on Saturday B) 8 pm on Tuesday C) 8 am on Tuesday D) 9 pm on Thursday E) 12:48 pm on Wednesday F) They won't grow that longThe epidermal growth factor receptor (EGFR) activates a complex signaling network to increase expression of several genes and promote cell proliferation as shown in the figure below. EGF Active EGFR Inactive EGFR Inactive EGFR P- EP Inactive Ras-GDP Ras-GTP Active Raf -P NUCLEUS МЕК-F МАРК-Р Active МАРК-P C-myc gene transcribed CYTOPLASM Cell proliferation Which of the following scenarios would result in decreased expression of the c-myc gene? Select all that apply A homozygous mutation of the EGFR gene resulting in a deletion of the ligand binding domain A homozygous mutation of the ras gene so that Ras protein was not able to exchange GDP for GTP A homozygous mutation of the ras gene so that Ras protein was not able to hydrolyze GTP for GDP A homozygous mutation of the MAPK gene so that MAPK protein was always in a phosphorylated stateThe output of RTK pathways is often the activation of MAP Kinase. Explain how MAPK can lead to activation of a specific subset of proteins, leading to distinct effects in different cell types in response to the same growth signal.
- Which of the following small GTP-binding proteins does NOT play a role in cell migration during chemotaxis? O Cap Z Rho Cdc42 O All of the listed GTPases play a role in cell migration O Rac ◆ PreviousCell lines divide normally in a defined medium containing growth factors, but fail to divide in the absence AGF (a growth factor). However, a mutant cell line continues to divide even in the absence of AGF. Elevated levels of Rb phosphorylation and the effects of receptor and Mek inhibitors suggest a mutation activating an oncogene. Inhibitors of Mek inhibit cell division of the mutant cell line, but inhibitors to the ADGF receptor, a receptor tyrosine kinase (RTK) with homology to EGFR, do not. Outline the RTK pathway leading to the phosphorylation of Rb to form p-Rb.The epidermal growth factor receptor (EGFR) activates a complex signaling network to increase expression of several genes and promote cell proliferation as shown in the figure below. EGF Active EGFR Inactive EGFR P- Inactive EGFR Inactive Ras-GDR Ras-GTP Active Raf -P МЕК- Р NUCLEUS МАРК-Р Active МАРК-Р C-myc gene transcribed CYTOPLASM Cell proliferation Which of the following scenarios would result in increased expression of the c-myc gene? Select all that apply. A homozygous mutation of the EGFR gene resulting in a deletion of the ligand binding domain A homozygous mutation of the ras gene so that Ras protein was not able to exchange GDP for GTP A homozygous mutation of the MAPK gene so that MAPK protein was always in a phosphorylated state A homozygous mutation of the ras gene so that Ras protein was not able to hydrolyze GTP for GDP
- The cell enters g1 and cyclin D binds with CDK4/6 Increases in cyclin D expression prevent p21/p27 from inhibiting cyclin E/CDK2 Rb is hypo-phosphorylated E2F is no longer repressed and induces expression of E2F and cyclin E The cell enters S phase and cyclin A binds to CDK2 cyclin A binds to CDC 2 > Cell enters G2 and cyclin B binds CDC 2 Cell enters M phase and proliferates Rb is hyperphosphorylated Upsteam signaling pathways lead to increase of expression of Cyclin D put in correct order from 1-10The cell enters g1 and cyclin D binds with CDK4/6 Increases in cyclin D expression prevent p21/p27 from inhibiting cyclin E/CDK2 Rb is hypo-phosphorylated E2F is no longer repressed and induces expression of E2F and cyclin E The cell enters S phase and cyclin A binds to CDK2 cyclin A binds to CDC 2 > Cell enters G2 and cyclin B binds CDC 2 Cell enters M phase and proliferates Put these in the correct order from 1-8Epidermal growth factor is a mitogen, because it stimulates cells to divide. (1) Explain the role of Ras in epidermal growth factor signaling that results in cell division. (2) Design two experiments to prove that Ras is a key player in the EGF-activated pathway. (3) What assay other than cell division could you use to assess whether the EGF-Ras-MAPK pathway has been activated?