In RNA OH group is present at 2' position True O
Q: is amino acid 213 in 1mry is THR ?
A: 1MRY crystal structure represents the structure of the akt2 kinase domain. It belongs to a…
Q: A C -1/a K 1-a' Wen a'Nmax (a-1) Var 1/v₂ 1/5) Slope - akma (1) a=1+- am 1 (no inhibitor) Increasing…
A: The Lineweaver–Burk plot or the double reciprocal plot is a graphical representation of the…
Q: Bacteria have a membrane potential, although the mechanisms of how it is maintained differ from…
A: Membrane Potential: It represents a balance between the equilibrium potentials of the ions that can…
Q: A. Dr. Randy Schekman introduced you to a yeast model system for studying membrane fusion and…
A: "Since you have posted a question with multiple sub-parts, we will solve the first two subparts for…
Q: At the center of all 20 standard amino acids is what is termed the a-carbon that is covalently…
A: Proteins are made up of amino acids and each amino acid has different functional group (R- group).…
Q: During each cycle of B-oxidation of fatty acid, all the following compounds are generated except…
A: Beta-oxidation is the process by which long chain fatty acyl CoA is degraded. Fatty acid oxidation…
Q: In competitive inhibition, increasing concentrations of the inhibitor will have the following effect…
A: When a molecule inhibits the enzyme activity that is called enzyme inhibition and the molecule is…
Q: give the significance/role/effect of the reagent/condition in the isolation or analysis of a…
A: The classical method of lipid extraction from egg yolk is the 2-Propanol/Hexane solvent extraction…
Q: ) how many turns are in this alpha-helix? Should be an integer b) length in angstroms?
A: Alpha helix is the secondary structure of protein formed by Hydrogen bonds between side chains of…
Q: Q/Why was the benedicts reagent useful in for determining the amount of glucose the urine?
A: Benedict's test is a test which detects the presence of reducing sugars in a sample. The reducing…
Q: Describe the importance of Wee1, Myt1, CAK and cdc25 activity on the activation of the cyclin B/CDK1…
A: CDKs are the proteins whose concentration increases or decreases during the cell cycle. The…
Q: UDP-glucuronosyltransferase enzymes bind the organic compound UDP-glucuronic acid (UDP-GA) in order…
A: Introduction: The major site for drug metabolism is the liver. It can be metabolized by oxidation,…
Q: Which of the following statements is true about non- essential amino acids? Oa) Can't be synthesized…
A: Non-essential amino acids are defined as those that can be synthesised in the body. Glycine,…
Q: Which one of the following statements about the control of enzyme activity by phosphorylation is…
A: Kinase: It is an enzyme that catalyzes the transfer of phosphate group to other molecule. This…
Q: Draw the peptide PVLED and determine the following: Isoelectric point, pI The net charge at pH =…
A: The given peptide is composed of proline, valine, leucine, glutamic acid, and aspartic acid. The…
Q: Discuss the underlying biochemical principle of the nucleic acid sequencing methods known as…
A: One of the techniques for figuring out the sequence of DNA or RNA is called next-generation…
Q: The concentrations of pyruvate, NADH, H+, lactate, and NAD are 2, 1.5, 1.5, 1.2, 1.2 mm,…
A: The quantitative study of the energy change from one form to another in the living cells and of the…
Q: Type I diabetes is caused by autoimmune destruction of the pancreatic beta cells True O False
A: Diabetes is a very common disease in the world. It is associated with metabolism of glucose. It can…
Q: Our body can get pentoses from * O (A) Glycolytic pathway O (B) Uromic acid pathway O (C) TCA cycle…
A:
Q: The transition state means that: a. fewer molecules have the energy required to reach the…
A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation…
Q: sing equilibrium argument, why does Km apparently increase, decrease or stay the same in…
A: Inhibition in biochemistry occurs in different enzymes. Inhibition of enzymes means blocking or…
Q: Which of the following is true about the phosphorylation of proteins? A. Proteins are usually…
A: Protein phosphorylation is a mechanism that helps regulate proteins' function as well as transmit…
Q: Which of the following statements is true? a) High insulin/glucagon ratio activates lipolysis in…
A: Lipolysis is the process in which the lipid, triacylglycerol is broken down into its components…
Q: antibiotics that bind to 30S ribosomal subunit trimetjoprime chloramphenicol sulfonamide…
A: Antibiotics affect the growth of bacteria by inhibiting various metabolic pathways, replication,…
Q: Assume that the extinction coefficient for DNA at 260 nm is 20 g-1 x L x cm-1. What would be the D…
A: Extinction coefficient, sometimes called "extinction coefficient" in meteorology or climatology,…
Q: Use the Michaelis-Menten plot to answer this question. What is the estimated value of Vmax of the…
A: Vmax : Reaction rate- when the enzyme gets fully occupied by substrate. Vmax- Maximum velocity
Q: True or False In the presence of enzymes, the value of free energy of activiation (delta G°‡) for…
A: Enzyme: It is a biocatalyst that increases the rate of chemical reaction by lowering the the…
Q: Before restrictive legislation, trans fats were O mostly derived from meat, they raise LDL and lower…
A: Trans fat are the most unhealthiest fat. Increased level of trans fat in the diet may increase the…
Q: write true if the statement if correct and change the bold word/phrase to make it correct "lower"…
A: After a carbohydrate rich meal, the blood glucose levels increase due to the reason that more amount…
Q: CH3CO-ETATKAELLAKYEATHK-CONH2 4. A polypeptide comprised of 17 amino acid res- idues with the…
A: Polypeptide: These are chains of amino acids with peptide bonds that connect them. Dehydration of…
Q: CHO CH₂OH CHO НО -H но- -H H-OH -OH H-OH НО -H H- HO-H H-OH CH.OH CH₂OH CH2OH PAS PES 16. an epimer…
A: The name for the following compounds are : PAS - D-arabinose PES - L-xylulose PIS - D-xylose POS -…
Q: 6E. Draw a reaction coordinate diagram describing the different steps of ATP synthase catalysis,…
A: ATP synthase is localized in the inner mitochondrial membrane enzyme and catalyzes the synthesis of…
Q: What is the relation between GMO crops and the four of the principles of bioethics? What issues are…
A: A GMO, or genetically modified organism, whose genetic makeup has been modified using scientific…
Q: UV light causes the conversion of a dietary form of vitamin D into vitamin D3 True O False
A: Vitamin D is the sunshine vitamin. Sun induced vitamin D synthesis is greatly influenced by season,…
Q: During ketosis brought on by a ketogenic diet, liver gluconeogenesis rates are high
A: Ketosis is a process when body starts burning the fats for energy due to insufficient amount of…
Q: The free energy difference going from the unfolded state to the folded state in most proteins is…
A: The three dimensional structure of proteins ca b e destroyed by denaturating the protein. This…
Q: Chemistry Draw the stable form of the peptide Ser-Trp-Glu-Asp-Cys-Asn at pH 10.40. Be sure to…
A: At pH 7 this is how a oligopetide of Ser-Trp-Glu-Asp-Cys-Asn looks.
Q: Which of the following intermediates serve as the brain’s primary source of energy during prolonged…
A: Starvation is the stage during which there is an unavailability of food and there occurs a drastic…
Q: rederick the Great believed that this drug would make his soldiers unfit to fight a war: coffee O…
A: Frederick II of Prussia, aka Frederick the Great, is the most famous an one the most notorious…
Q: Mach the terms left with as many terms GMP Nucleotide at right by entering @ Nucleoside 3 Z-DNA…
A: Thank you for your question, Here is the answers for the above match the following with…
Q: Explain the chirality of amino acid molecules.
A: If any combination of rotations, translations, and conformational changes cannot superimpose a…
Q: Describe the chemistry involved in the processes of Lipid Interesterification and Lipid…
A: Lipid interesterification is a process where the structure of a lipid is changed by altering the…
Q: From the Lineweaver-Burke plot of an enzyme-catalyzed reaction containing 4 μM total enzyme, you…
A: Hi. Thank you for the question. As per the honor code, We'll answer the first question since the…
Q: * What are the different forms (i.e., monomers, polymers) of carbohydrates, lipids, and proteins? *…
A: A biomolecule is generally a carbon based organic compound that is produced by living organisms.…
Q: f the following statements is/are FALSE? aramagnetic metal ions can have an odd number of electrons.…
A: The crystal field theory is used for giving the description of the metal-ligand bond. The…
Q: Select all criterion for classifying a substance as a neurotransmitter. (select all that apply)…
A: Neurotransmitters are chemical messengers that are employed by the body to transmit nerve impulses…
Q: The base that is circled in red could be adenine thymine guanine None of the provided answer choices…
A: The molecular basis of heredity is DNA. It can be thought of as a genetic information reserve bank.…
Q: How do you do a DNase footprint assay. What did it demonstrate in regards to the UP elements binding…
A: The DNase footprinting technique is a DNA footprinting technique. It cannot be confused with…
Q: Using the DNA sequence Genetically modified TAC CAG ATA CAC TCC organisms (GMOs)- CCT, create the…
A: A mutation is an alteration in the nucleic acid sequence of a gene encoding a protein. Mutations…
Q: Intermolecular forces of attraction, such as hydrogen bonding and van der Waals forces, are…
A: Non-covalent interactions play a major role in the assembly and function of biological…
Step by step
Solved in 2 steps
- Second letter A UUU UCU) UC UCA UCG UAU UUC Phe UUA Tyr UGU UGCJ Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUG Leu CAUHIS CUU CUC CUA CUG CCU* C ССА CCG CGU His САС Leu CGC Arg CGA Pro CAA Gin CGGJ Gln Which amino acid is carried by the TRNA with the anticodon 5'-UCA-3? ACU ACC ACA AAU AAC. AGU AGC AGA AUU Ser Asn AUC Ile A AUA Thr AAA Lys AAG Lys AGG Arg AUG Met ACG GAU GGU] GUU GUC GUA GUGJ GCU GCC GCA GCG GAC Asp Ala GAA GGC Gly GGA Val GAG Glu GGGJ Isoleucine. None-this is a stop codon. Aspartic acid. Histidine. IV. Leucine O V. Third letter UCAG UCAG UCAG First lettert RNA is 3`UAC 5` so m RNA -5` AUG 3` but why mRNA can not be the 5'GUG'3 based on wobble pairing rule. THANKS(ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?
- GENE E DNA TTTAA A MRNA Amino AcidName: Date: 2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this s sequence into MRNA. er bns eldst eboo oi ebitqeqylog erlt to noihiog eri qu elsm bluow tsri abios onime Jlaw as ye s 1ot noitem atelomet AHG 3. The following MRNA ştrand is being used to asemble a polypDNA TTA CAT TAC MRNA AUG UCG GGA AAA UGA Amino Acid Val Cys
- 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…"a messenger rna is 423 long how many amino acids it can code"Energy that drives translation is provided mainly by ___ . a. ATP b. amino acids c. CTP d. all of the above
- Nucleic Acids Convey polypeptide c' minal directi This ques similar to t' carboxy-ter- hesis ing synth to direct sis, the Secon yase aft e genetic groups of 44. Why is ATP important to protein function, and how is it used to accomplish this? which st is. The m fatthaei, synthetic able of r ataining r thus mus ucleotid h of mor Cwas the chemis re critir a 1966 ponded han our PROT mine the s tetail sizerStiffening of the arteries, joints, and lensesin old age may be a result of cross-linkingbetween ______ moleculesPLEASE FL OUT TABLE USING INSTRXUTIONS -USE BASE PAIRING RULES TO COMPLETE SECOND COLUMN FOR EACH MUTATION WRIYE IN ANY MRNA DOEONS RHAT WILL BE FHANGED AS THE REEULR OF RHE MURATION AND USE X MARKS RO INDÍCATE DOONS THAT WONT BE FHANGES CIRCLE STOP CODONS