i need the answer quickly
Q: Which of the following refers to the test performed 2 hours after an overnight-fasted patient was…
A: Different tests are used to test the blood glucose level.
Q: Which of the following condition is NOT associated with riboflavin deficiency? * (Please choose one…
A: Riboflavin is a water soluble vitamin. It is also called as B2 vitamin. Foods like pork, eggs,…
Q: 3. Identify if the following is a pyrimidine/purine nucleotide or a pyrimidine/purine nucleoside and…
A: Hi, Thankyou for posting your question on Bartleby. As per the guidelines we are allowed to answer…
Q: Both reducing monosaccharide and disaccharide give positive result in Barfoed's test. Which of the…
A: Barfoed's test is done to differentiate between monosaccharide and disaccharide.
Q: II. Effect of temperature Observation(Time taken for the disappearance of blue-black colour) Test…
A: Introduction: Enzymes are organic biocatalysts that fasten the rate of chemical reaction that is…
Q: Given Sorbitol, Briefly explain its expected reaction (based on their structural formula) to the…
A: Molisch's test is the specific test for Carbohydrates which give purple colour ring on addition of…
Q: 9. Which of the following statements about trypsin, chymotrypsin, and elastase are true? A. They are…
A: Trypsin, Chymotrypsin and Elastase all three are protein digesting enzyme which uses its active site…
Q: When specific conditions are met, the creation of peptide bonds rather than the hydrolysis of…
A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…
Q: A) Discuss the significance of anomeric carbon in carbohydrates. B) Explain the differences between…
A: Anomeric carbons represent the carbon around which anomers rotate. This anomeric carbon is a…
Q: How many molecules of NADH are produced if 12 molecules of glucose enter the glycolytic pathway?
A: Glycolysis is a catabolic process which occurs in cytosol.
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Q: A mixture of Alanine (pl 6.02), Glutamic Acid (pl 3.22), Glycine (pl 5.79), Lysine (pl 9.74) and…
A: Ion exchange chromatography is used to separate molecules based on their net surface charge.
Q: Enzymatic digestion of carbohydrates starts in the mouth. True False
A: Enzymatic digestion is generally referred to as the act of breaking down ingested food materials,…
Q: Match lipid structures in column A with its lipid type in column B
A: Lipids are the group of organic components having oily or greasy consistency. Lipids are a group of…
Q: Maintaining blood glucose levels above 40 mg/dL is important so that all cells are able to take in…
A: Glycogen is a polymer with a branching structure. Carbohydrates are stored in this form in the human…
Q: 1) Below you are given the structures of the disaccharides lactose and trehalose. но OH OH OH но но…
A: Lets first assume that all the carbohydrates given here are D isomers , cause that the general case…
Q: 1. What are the three major pathways that eventually become entry points of molecules into the Krebs…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…
Q: Question 4 Match the each enzyme deficiency with their corresponding disease B-hexosaminidase A A.…
A: Enzyme deficiency results in certain metabolic disorders and results in serious diseases.
Q: Which of the following statements is CORRECT regarding the following intermediate? H2N H NH2
A: "Since you have asked multiple questions, we will solve the first question for you. If you want a…
Q: When can we say that it is an essential amino acids and non essential amino acid? Choose two amino…
A: Introduction: Amino acids are biomolecules that contain an amino and a carboxyl group-containing a…
Q: Identify the dependent variable in the experiment whose data are graphed in Figure 2. Identify the…
A: Caspases are a type of protease enzyme that plays an important part in programmed cell death.…
Q: 17/18 Instructions; • Answer the Question properly and accordingly. • Do not copy here in Bartleby…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: A mixture of Asparagine (pl 5.41) , Aspartic Acid (pl 2.98), Histidine (pl 7.59), Lysine (pl 9.74)…
A: Cation exchange chromatography separates the molecules based on their net negative charge. Cation…
Q: Explain how the crystal structures of potassium ion channels suggest the way in which the…
A: Potassium channels ubiquitously exist in almost in all kingdoms of life and perform very diverse but…
Q: You are analyzing the peptide ala-ile-glu-lys-phe-val- tyr-cys. If you treat the peptide with…
A: Proteins or peptides are a linear chain of amino acids attached together via peptide bonds. Natural…
Q: What enzyme(s) control the total levels of cGMP in a cell? Is guanylyl cyclase one of the enzymes?
A: Cyclic GMP or cGMP is a second messenger molecule during the process of signal transduction.
Q: Failed to follow
A: Waxes are a broad category of organic compounds that are lipophilic and bendable solids at room…
Q: You'lre hungoy, body Cmuttiple g the following e optim posei ble) which Occur in Our toonelete (A) À…
A: Hungryness is a feeling that stimulates food intake. There are number of pathways that stimulate…
Q: What is the significance of the positioning of the amino acid side chains and alpha carbons as you…
A: Proteins are polymers of amino acids linked by peptide bond/amide bond. Peptide bond is a covalent,…
Q: Question 12 C17H29COOH O linolenic acid O non-saponifiable O w-3 fatty acid O All are correct
A: C17H29COOH - It has double bonds at 9, 12, 15th carbon position
Q: All these enzymes hydrolyze disaccharides in the small intestines EXCEPT O maltase O amylase O…
A: The main carbohydrate contained in our meals is sucrose, lactose, and starches. Cane sugar, milk,…
Q: Calculate the fractional charge on ASP at pH 3 using the following pKa values (1. 9.90, 3.90). Write…
A: A total of 300 amino acids are present in the biological system out of the 20 are part of…
Q: Choose the wrong, Release of energy (ATP) comes from the Select one: O a. when the terminal…
A: ATP is the energy currency of the cell.
Q: Where does molecular oxygen (O2) get generated during photo-phosphorylation? Photosystem I 2…
A: The light reaction, also known as photolysis reaction, occurs in the presence of light. It mainly…
Q: +3 -1.5 +1 +2 -1 +1.5
A: Amino acids are organic molecules having an amino group and an acid group. Amino acids are…
Q: The parasite Trypanosoma brucei, which causes sleeping sickness, uses proline as an energy source…
A: A transport mechanism that works to facilitate the movement of substances in and out of the cell…
Q: Which of the following enzymes is the key regulatory step in glycolysis? Phosphofructiokinase-1 is…
A: Glycolysis is a series of reactions that break down glucose into two three-carbon molecules known as…
Q: ion. What cause mentioned changes? For the
A: Amino acids are building blocks of proteins which can be divided into two group based on its…
Q: It is important to maintain a clean home and clean self because 1). We can make use of soap and…
A: Introduction Soaps and detergents These are the chemical substances which dissolves in water and…
Q: Question 24 CH,-0-C-(CH,)14–CH, CH-0-C-(CH,)16-CH, CH3 сH, —о—р—о—сH, — сн, — N—сH, CH, What is the…
A: Depending on the strut of lipid ,they are classified as simple and complex lipid. Simple lipids are…
Q: RNA processing events include A. self splicing B. methylation of 45S FRNA C. snoRNA facilitates…
A: Introduction: RNA processing involves newly transcribed RNA molecules (primary transcript)…
Q: 7. What is the base sequence, specified in the 5' to 3' direction, for a segment of newly formed DNA…
A: The genetic material in most organism is double stranded DNA with the two strands running in…
Q: LIPIDS Functions Chemical Components 1. 1. 2. Two Primary Categories of Lipids 2. 3. 3 4. Two…
A: Functions of lipids: 1. Storage of energy 2. Transmit nerve impulses 3. Structure of cell membranes…
Q: Enzyme X and Enzyme Y both react with the same substrate S. In each reaction with S, 10 µM enzyme is…
A: A substance called an enzyme acts upon a substrate molecule and reduces the amount of activation…
Q: They are related in str They have identical ba C) they are the result of a
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: ). Isoniazid (MAO inhibitor) is prescribed to the patient with Parkinson discase. What does cause…
A: Parkinson's disease: A long term degenerative disorder of central nervous system.
Q: When is it appropriate for gloves to be worn? Check all that apply. O Only if you have.time O Only…
A: As part of standard precautions to reduce the risk of contamination for health care providers, the…
Q: he figure shows that the average distance between base pairs measured parallel to the axis of a DNA…
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotides is an…
Q: 1. Glucose synthesis was investigated in isolated hepatocytes. Different amino acids were added to…
A: Amino acids are building blocks of proteins which is consist of amine group, carboxylic group,…
Q: CH3 CH3 CH3(CH2)n: O sterol O Cholesterol O Lysophosphatidylcholine O Cholesteryl ester
A: Sterols are important sub groups of steroids that contain OH at 3rd position of A ring of structure.…
Step by step
Solved in 3 steps with 1 images
- 8. In patients after prolonged hepatitis, the ALT and AST activities were measured in the blood serum. What transaminase activity is inereased to a greater extent, and why? For the answer: a) explain the meaning of the enzyme diagnostics; b) draw the scheme of reactions catalyzed by ALT and AST; c) point out coenzyme of these reactions; describe vitamin from which this cocnzyme is derived; d) describe the biological importance of this type of reactions in amino acid metabolism; e) specify the demands which are claimed to enzymes been used in enzyme diagnostics.8. Ketone bodies were found in the urine of the patient with diabetes mellitus. Explain the sequence of metabolic changes resulting in ketonuria. For that answer the question and do the following tasks: a) what are the ranges of ketone bodics in blood of the healthy pcople and the patients with diabetes mellitus? b) explain the main changes in hormonal regulation of patient with diabetes mellitus; c) explain why the level of free fatty acids in the blood is clevated; d) name the pathways of lipid metabolism which becomes more active in patients with diabetes mellitus; e) draw the scheme of ketone body synthesis and oxidation.(c) Discuss the mechanism of action of the enzyme chymotrypsin.
- 8. Hypercholesterolemia is a frequent complication of diabetes mellitus in patients with prolonged hyperglycemia. Why a high level of glucose in blood causes hypercholesterolemia and atherosclerosis? For the answer explain: a) how glucose can interact with the proteins and the consequences of this reaction for the proteins; b) glycation of which proteins results in hypercholesterolemia; c) possible causes and complications of hypercholesterolemia.3. A patient has got excess carbohydrate meal for the years and gain the weight. To explain this: a) draw the schemes of TAG synthesis in the liver; b) describe the transport of TAG from the liver to adipose tissue; c) describe the functions of insulin in the conversion of glucose to TAG in the liver and adipose tissue. Glucose containing Catoms was added to isolated hepatocytes inanexperiment. Ifthe glucose was added in excess, the rate of triacylglyccrol synthesis increased.3. After 12 days of starvation, a man reduced his weight by 4 kg. The doctor prescribed him biochemical blood test to analyze the level of lipids in serum blood. The results showed an elevated level of free fatty acids and triacylglycerols. Explain the results of the biochemical blood test. For that: a) name the main hormone which manages metabolism during starvation; b) draw the scheme of this hormone action on the adipose tissue; c) name the possible pathways of fatty acids usage in the liver during starvation and write down the proper schemes.
- .26: Regarding thioamides: ese (a) they include chlorambucil (b) methimazole is less potent than propylthiouracil (c) the bioavailability of propylthiouracil is less than 25% (d) their prolonged use may result in gastrointestinal distress (e) the most dangerous complication is agranulocytosisWhy is it important to be knowledgeable about the benefits of taking vitamins in our body and the dosage recommended to intake? How precursor related to the vitamins(long explanation pls) Why is it significant to determine the importance of dietary supplements, including their active agent, and to know if it is necessary or not? (long explanation pls) kindly answer :)) thank you so much!8. The adipose tissue is not only store triacylglycerols but also is active endocrine organ. Explain this function of the adipose tissuc. For that: a) explain the «clinical obesity» and possible consequences of the discase; b) name the biologically active molecules secreted by the adipose tissue; c) explain how secretion of these molecules changes with development of obesity. 9. A daily dict ofa 55-ycar-old woman, consisted ofa 500 g of carbohydrates, 100g of animal fats and 150 g of proteins, at the background of low physical activity.
- 26: Regarding thioamides: ale lon (a) they include chlorambucil (b) methimazole is less potent than propylthiouracil (c) the bioavailability of propylthiouracil is less than 25% (d) their prolonged use may result in gastrointestinal distress (e) the most dangerous complication is agranulocytosis8. In patients with diabetes mellitus type I, the biochemical disorders result from changes in fuel metabolism. One of these signs is acidosis. Explain why such patients have a deviation of blood pH from the norm? For this: d) specify the hormone that accelerates this precursor formation and provide appropriate charts, starting from the hormone binding to adipocyte and concluding with precursor formation, give an explanation to the charts.1) Discuss recent findings on the effects of consumption of cholesterol and saturated, polyunsaturated, and monounsaturated fats. Give examples of each type of fat. 2) We often think only of DNA and RNA as nucleic acids. Discuss the role of other, less “well-known” nucleic acids, such as cAMP, cGMP, NADH, NADPH, and FADH. 3) Collagen is a very important structural protein in animals. Discuss the various parts of the body in which collagen is an important structural molecule and what its function is at each body location.