Failed to follow
Q: -Inhibitor +Inhibitor [S] (mM) Vο&νβσπ: (μmol/sec). Vο&νβσπ:&νβσπ: (μmollsec) 0.0001 33 17 0.0005 71...
A: From the given data, I have calculated 1/S and 1/V0 in absence and presence of inhibitor. The plot b...
Q: Please provide a chromatography technique to isolate the protein A from the mixture containing prote...
A: Protein A :- positively charged Protein B :- negatively charged For separation of charged molecules ...
Q: Restriction mapping of a plasmid: Digestion of a plasmid pCHEM1234 with the following restriction en...
A: Here pCHEM1234 is digested with BamH1 and HindIII individually and in combination. Plasmid vector is...
Q: Choose among proteins A, B, C, and D. 1. Protein that will most strongly bind to an anion exchange ...
A: Chromatographic techniques are used to separate specific molecules from a mixture of different molec...
Q: 1. Draw NEW amino acids; name them and characterize them 2. Make two dipeptides with your two new am...
A: Amino acids contain amino group and carboxyl group along with R side chain. The R side chain defines...
Q: Matching type. Match the following disaccharides with their corresponding monosaccharide units Galac...
A: Disaccharides are the class of carbohydrates that consist of two monosaccharides joined covalently b...
Q: a reasonable biosynthesis for Compound 14 starting from Propose alanine, S-phenylalanine and ATP.
A: Given compound in a figure is Aspartame. It is an artificial sweetener and is made by dipeptide of a...
Q: Which of the following statements regarding size exclusion chromatography is false? During siz...
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first...
Q: Compare and contrast the structure of lipids, nucleic acids, carbohydrates, and proteins (with refer...
A: Carbohydrates, proteins, lipids and nucleic acids are biomolecules that are important for the physio...
Q: What chemical structure should be present in an amino acid or protein to give a positive Xanthoprote...
A: "Since you have asked multiple question, we will solve the first question for you. If you want any s...
Q: Proteins are compounds composed of many _________ linked together
A: The protein which is most important constituent for every living organisms. The term protein firstly...
Q: Dopamine, norepinephrine and epinephrine are collectively called catecholamines. Which of the follow...
A: Catecholamines are group of hormones made by adrenal glands and its is secreted the chromaffin cells...
Q: A HEPTAPEPTIDE that punctures the bacterial cell wall has just been recently isolated from the venom...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids con...
Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase ...
A: Pyruvate carboxylase (PC) is a ligase class enzyme which catalyze the irreversible carboxylation of ...
Q: (a) A solution containing these five proteins was adjusted to pH 7.0 and then applied to a SIZE-EXCL...
A: Chromatography is a method of separation of specific compounds from the mixture of compounds. This c...
Q: We have described an ATP synthase complex with an Fo complex of 9 c-subunits. Consider if the F0 com...
A: In order to solve this problem, first we need to identify the reaction catalyzed by the enzyme β-hyd...
Q: 32. Which one of the following is NOT a typical characteristic of the active site of an enzyme? A) T...
A: Substrate molecules bind to the enzyme, which then undergoes a chemical reaction. The active site is...
Q: What is the AG for the following reactions: ATP + H20 → ADP + P. AG= ADP + P → ATP + H20 AG =
A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the firs...
Q: How can we use software to identify restriction-enzyme cutting sites in sequenced DNA ?
A: Restriction analysis is the process of identifying restriction mapping sites in DNA sequences by emp...
Q: Vitamin A in vision Vitamin C in collagen formation Vitamin K in blood clothing
A: Vitamins are the organic compounds that requires in small quantities. Vitamins have wide variety of ...
Q: Suppose you want to determine if excessive lipid ingestion altersgene transcription. Describe and ex...
A: Dietary fat is a crucial macronutrient for the increase and development of all organisms. In additio...
Q: Design the simple process scheme diagram for (fermentation and recovery of glutamic acid from palm w...
A: The breakdown of carbohydrate under anaerobic condition is referred to as fermentation. In absenc...
Q: The transcription of a gene called YFG (your favoritegene) is activated when three transcription fac...
A: An enhanceosome is a group of trans-acting factors that assemble at an enhancer region of a gene to ...
Q: Q1: Explain the effect of pH value on the amino acid ionization. Q2: Describe two reactions for amin...
A: Amino acids and their ionization: Amino acids are the basic building blocks of proteins, they are bi...
Q: I. True or Flase a. An inhibitor may compete with the substrate for binding to the active site of ...
A: Enzymes are proteins which act as biocatalysts. Enzymes increase the rate of biochemical reactions a...
Q: Biochemistry Question: Nonenzymatic glycosylation or glycation creates glycoproteins by
A: Glycoproteins are molecules that comprise protein and carbohydrate chains that are involved in many ...
Q: (a) Propose a biosynthetic pathway to the secondary metabolite, B. OH O HO Metabolite B
A: The given metabolite structure is derivative of Salicylaldehyde and synthesized by plant as secondar...
Q: Enumerate the five classification of lipids based on function.
A: Lipid, any of a wide range of organic molecules that do not interact significantly with water, such ...
Q: What are nucleosides?
A: Nucleosides are compounds consisting of purine or pyrimidine bases linked to sugar. The nucleobase c...
Q: A. Heteroglycans are polysaccharides with only one type of monosaccharide unit. Heparin is a heterog...
A: Polysaccharides that are comprised of same type of monosacharide units, then it is termed as homopol...
Q: What name is given to the predominant secondary structure found in wool protein?
A: Because estimating tertiary structure only based on amino acid sequence may not be sufficient, secon...
Q: Each group will be provided with 20 g double-stranded DNA oligomer in STE buffer (0.1M NaCl/ Tris/ ...
A: Tm, the temperature at which a double stranded DNA is half denatured is dependent on the length and ...
Q: why the hemacytometer method is not compatible with mycelium b. Explain at what stage of growth the ...
A: Cell counting: Hemocytometer or cell counting chember is used for primary cell counting, where a th...
Q: You have a friend who lost 7 kg (about 15 pounds) of fat on a regimen of strict diet and exercise. H...
A: Fats are energy molecules that is usually ester of fatty acids called as triglycerides. It can be so...
Q: Explain the importance of knowing the conformation/structure of proteins.
A: Proteins are biomolecules composed of amino acids. The amino acids are joined together through pepti...
Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT ATGGGCCATATTGCGACC...
A: DNA strand given here with directionality is as: 5’ TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCCAAA...
Q: Name the peptide * он H,'N-CH-C-N-CH-C-N-CH-C-O CH, CH-CH, CH, H он H. CH, CH, CH, SH CH, Methionyl-...
A: Peptides are composed of amino acids linked to each other via a peptide bond. Peptides are named fro...
Q: What factors affect blood glucose levels? Explain
A: Several factors affect glucose levels in the blood, like food, physical activity, medicines are the ...
Q: What is the general definition of an uncoupler protein? In the context of oxidative phosphorylation,...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: Use the image below to determine what stage of the dog's life cycle is spent in the haploid state? (...
A: Haploid stage is the condition at which cell contains only one set of chromosomes in its nucleus Dip...
Q: Which of the following saccharides is INCORRECTLY described? * A. D-mannose: Monosaccharide: P...
A: Carbohydrates are macronutrients that the body requires for energy production. Carbohydrates provide...
Q: Show the amount of ATP were produced in beta-oxidation of lauric acid, and differentiate both the GR...
A: Lauric acid has a 12-carbon backbone and is a saturated medium-chain fatty acid. Under anaerobic and...
Q: 12. RNase A is a ribonuclease enzyme that degrades single stranded RNA. There are three key amino ac...
A: RNaseA catalysis is a typical example of acid base catalysis. Histidine is a common amino acid in th...
Q: Chargaff rule applies to a ss RNA b All Polynucleotides c ssDNA d dsDNA
A: Chargaff rule was stated by Austrian born chemist Erwin Chargaff. The specifies about the 1:1 ratio ...
Q: A bowl of pasta contains 45 g of carbohydrates. How much energy can possibly be released after its c...
A: Total Carbohydrate in pasta = 45g Molecular weight of Glucose = 180 g/mol
Q: discuss any complications of acidity or alkalinity of foods on another organ or system in the body? ...
A: pH is the measure of the strength of H+ ion or Hydronium ions in solution. pOH is the measure...
Q: 2. Calculate the overall charge (pH 7) on the following three polypeptides and answer the questions ...
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have...
Q: _____________ is a tranquilizer that is also known as the “date rape” drug. a. Halcion b. Librium c....
A: Tranquilizer is a drug which is used to reduce anxiety and stress. Dopamine is a neurotransmitter wh...
Q: 23 Which statement describes a disease state caused by altered protein structure? OAslent mutation i...
A: Diseased state can be caused by altered protein structure. Protein can be altered by Mutations that ...
Q: 1. An extruded breakfast cereal was analysed for total fibre using AOAC Method 991.43 (AACC Method 3...
A: Dietary fibers are mixture of soluble/insoluble polysaccharide, non-digestible oligosaccharides, cut...
Step by step
Solved in 2 steps
- 1. What is a Lipid profile? 2. What happens if lipid profile is high? 3. What are the warning signs of high cholesterol?Which of the following is not a carbohydrate? A. С. надон HOC-ROH ОН на на го B. D. НО НО ОН ОН ОН34. Which fatty acidis most likely to bea solid at room temperature? a. CH он b. CH, CH OH CH,-C-OH C. CH, CH=CH CH CH, CH=CH, CH d. CH, CH CH CH -C-OH
- 1. Lipids are found in: a. Bread b. Oils/Fats/Waxes c. Meat d. Chocolate 2. Give an example of an unsaturated lipid in your diet: 3. Give an example of a saturated lipid in your diet:1. What are the differences between unsaturated and saturated fatty acids? 2. What is Biological Value (protein)? 3. What is Chemical Score (protein)? 4. What temperature is your beverage optimal for rehydration?An individual is sailing off the coast of a remote area and is blown out to sea by a freak storm, whichalso destroys the main sails, damages the propeller, and disables the radio antenna. Aboard the boatare some minimal food supplies – some beef jerky, canned tuna, a roll of Life Savers candy – and anadequate amount of water. Assume that carbohydrate component of the sailor’s diet is severelyrestricted for several days until he or she is discovered and rescued but that he or she continues toeat adequate amounts of fats and proteins. Describe some of the adjustments that the person’s bodywould make to the unbalanced diet over this period of time
- all of the following statements regarding lipids are correct EXCEPT for A. lipids contain less energy per unit weight than carbohydrates B. lipids are the body's natural way to store energy long term C. lipids are harder to digest than proteins D. lipids are relatively uncharged E. most lipids cannot be broken down by the bodyle D... This is a/an: esc a) phospholipid b) lipid c) fatty acid d) carbohydrate 56B 1 Q A N @ 2 W S X # 3 OH a E D CH₂OH OH $ 4 TEC ОН C R FL OH % 5 22 T V MacBook Pro < 6 T!!! G Y B 11 & 7 H 2 * S1. Carbohydrates a. If lactose were to react with an acid or an enzyme within the gastric system, what type of compound(s) would be formed in the stomach? explain. b. If fructose is ingested, but in this case you have just taken an alkaline medicine (milk of magnesium, for example), what would be the result of this mixture in our stomach? c. Explain in your own words what the Benedict test is (use at least one example). d. Arrange the next molecule in a chain CH₂OH OH OH ОН OH Lo (Ctri) -
- Help me1. What elements do lipids contain? 2. Identify two (2) functions of lipids in the body. Explain each function in 2 sentences. 3. Label the parts of the below lipid molecule. Is this a saturated or unsaturated lipid? I-0- HIC I-0)-I C-C- I ннн H-C-H C-C H-C-I H-C-H I-C-I HH C-C-CH I H с 4 HWhat process is used to put fats together? Group of answer choices A. anhydric fusion B. chemical awesomeness C. dehydration synthesis D. glycolysis E. hydrolysis