How will you prepare 750 ml of the digestion buffer. Show all steps and calculations and remember to explain how exactly you will make it up.
Q: if we got a positive catalas test this is mean it is a positive result, what i do next ? oxidase or…
A: Catalase is an enzyme generated by bacteria which breath with oxygen that shields themselves from…
Q: Name FOUR polymers in your body right
A: Polymers are composed of many monomers attached together via covalent bonds. Polymers are made up of…
Q: Determine the number of carbon atoms present and the the total number of phosphate groups present in…
A: In our body, many metabolic pathways occur. In these pathways, Glycolysis also occurs to convert…
Q: Acetyl CoA + 2H* + 2e = pyruvate + COASH Ubiquinone + 2H* + 2e = Ubiquinol E* = -0.48 V E" = +0.04 V…
A: If the reaction has a positive value of standard cell potential/standard reduction potential or a…
Q: Determine the amino acids that compose the peptide shown below.
A: Amino acids are compounds with a carboxyl group and amino group attached to the same carbon atom.…
Q: Polymerase chain reaction cannot amplify complete circular plasmids. True False
A: Polymerase chain reaction or PCR is a technique which is used to amplify a sample of DNA and is one…
Q: (a) Draw the condensed structural formula, and give the name and abbreviation for the dipeptide…
A: Dipeptide is the structure formed by two aminoacids with a single Peptide bond. Anomeric carbon is…
Q: Can you please briefly describe the reaction mechanism that permits the detection of reducing sugars…
A: Fehling's reagent is a reagent commonly employed in differentiation of water soluble carbohydrates…
Q: HN-CH- HN-ÇH-C- -OH HN- CH 1 2 3.
A: Each amino acid has a N-terminal (-NH2 group), a C-terminal (-COOH group) & a R-group or the…
Q: . Label each statement about the polynucleotide ATGGCG as true or false. a) The polynucleotide…
A: Polynucleotides are found naturally in all living organisms and play a variety of roles in them. A…
Q: BACKGROUND A 2-year-old black girl is being seen by the hematologist after her pediatrician found…
A: Due to the lack of mitochondria, there is no TCA cycle occurring in the RBCs. So, RBCs obtain the…
Q: The activity of isocitrate dehydrogenase in E. coli is regulated by the covalent attachment of a…
A: Isocitrate dehydrogenase is an important Enzyme of TCA cycle for the conversion of isocitrate into…
Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: Is proteus vulgaris positive or negative in lia test? Why?
A: Proteus vulgaris is a gram negative bacteria that test positive for indole and catalase production.…
Q: Which of the following is the polyadenylation signal sequence? AAAAAA O AAUAAA O AAAUAA AAUUAA
A: Polyadenylation signal sequence :- is the signal sequence needed to add poly A tail at 3' end of…
Q: How many molecules of water are produced by the electron transport chain during the complete aerobic…
A: Stearate is saturated fatty acids. It is metabolized by beta oxidation in the cytoplasm. It releases…
Q: What diseases are the related protein deficiency in the human body? Explain their rationale.
A: Protein deficiency occurs in the human body when the body does not get enough amount of protein that…
Q: 4. Draw a reaction showing the reduction of coenzyme Q10
A: Primary coenzyme Q10 deficiency is considered as disorder which can affect many parts of the body…
Q: Sample Results Remarks Glycine A Egg white B Casein Tyrosine D
A: In a polypeptide chain the amino acids are linked together via peptide linkages.
Q: Describe why water is considered to be the most indispensable nutrient. Include a minimum of three…
A: A water molecule is made up of three atoms which include one oxygen and two hydrogen atoms. Most…
Q: explain the function of present vitamin c in oxalic acid
A: Many plants contain oxalic acid, which can be found in leafy greens, vegetables, fruits, chocolate,…
Q: Q2: What is the theoretical oxygen demand of sucrose 1.25 g/L solution? Write down the…
A: Theoretical oxygen demand : It is abbreviated as TOD. It is defined as the calculated amount of the…
Q: See attached. My topic is about biomolecules. Please explain the encircled nutrition fact labels.…
A: Introduction: Food labels help us determine the nutrient content of foods. It is important for most…
Q: True or False? a. RNA, DNA, and ATP are important macromolecules, are formed from simple…
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of…
Q: Consider the following peptide sequence: His-Pro-Lys-Arg-Ala-Gln-Ser-Cys-Pro Which test will the…
A: Proteins are polymers of amino acids in which the amino acids are linked together by peptide…
Q: Which of the following are nonessential amino acids in humans? valine aspartic acid proline…
A: Amino acids are monomers of protein they are linked with each other by forming peptide bonds.…
Q: residues listed below: (a) Ser195 (b) His57 (c) NH groups of Gly193 and Ser195
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first 3…
Q: Why is understanding reaction rates significant? Indicate at least 3 key importance of understanding…
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation…
Q: Reactions and Thermodynamics of Glycolysis
A: Third step of glycolysis, fructose-6-phosphate is converted to fructose- 1,6-bisphosphate by…
Q: Question 2 You are using molecular modelling software to examine the X-ray crystal structure of the…
A: Beta-Adrenoreceptor: They are GPCR and contain seven transmembrane helices. It is widely distributed…
Q: Consider the analogy of the jiggling box containing coins that was described on page 85. The…
A: When we face a situation where rate of forward reaction is euqal to the rate of backward reaction…
Q: Why are they so designated? Ketone bodies are so named because they contain the ketone functional…
A: Ketone bodies are produced by the liver during caloric restriction.
Q: (a) What is a reducing sugar? (b) Give an example of a reducing sugar (c) What test can be used to…
A: a. Reducing sugar:- Any carbohydrate thta reacts with an oxidising agent to form an aldonic acid is…
Q: Which steps below require an ATP to run?
A: "Since you have asked multiple questions, we will solve the first question for you. If you want a…
Q: What does protein function in the human body?
A: Proteins are made up of amino acids or we can say that amino acids are the building block of…
Q: What is a Ramachandran Plot?
A: Ramachandran plot is developed by G N Ramachandran, C Ramakrishnan and V Sasisekharan in 1963. This…
Q: Feedback See Periodic Table Which of the following correctly describe both a lectin and a…
A: Lectins are stated as either the proteins or the glycoproteins that are present in almost all…
Q: Why is it agreeable from a food safety point of view to keep soy sauce in your cupboard and not the…
A: Soy sauce is produced by the fermentation of soyabeans, grains, and brine using molds- Aspergillus…
Q: Answer the following multiple-choice questions and EXPLAIN in 3-5 sentences why you chose that…
A: Enzyme is basically biocatalyst that increase the rate of chemical reaction without itself being…
Q: 5. Protein tyrosine phosphatase-1B (PTP1B) is an important enzyme regulating insulin signaling be-…
A: PTP1B enzyme in question catalyze the hydrolysis of phosphorylated tyrosine on Insulin receptor and…
Q: How is a “committed step” defined in the context of a metabolic pathway and why are they important?…
A: A metabolic pathway is a chain of biochemical reactions linked together by their intermediates.…
Q: 1.A:Identify the three major chemical buffers of the body B : Choose one and describe the operation…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…
Q: Illustrate the biosynthetic pathway of resin 2. Give 5 industrial uses of resins
A: Resins : Resins are the amorphous products on complex chemical nature. These are usually…
Q: SMC proteins participate in DNA bending that contributes to folding and condensation. True False
A: SMC is expanded as Structural Maintenance of Chromosomes. SMC complexes are the ones that represent…
Q: With the aid of diagrams, describe how the body’s adaptive immune system responds to an infection.
A: Memory cells (B- and T-lymphocytes) are white blood cells that keep track of every germ the immune…
Q: In olfactory neurons, it is estimated that activation of the olfactory receptors results in an…
A: The olfactory epithelium of the nasal roof contains olfactory receptors. Each olfactory receptor is…
Q: At higher amounts of protein, the Bradford assay is not linear. Consider the plot to the right: what…
A: Bradford assay is used to determine the unknown concentration of proteinbin a sample from standard…
Q: Which of the following is a transition mutation? OC--> G OC --> T OC --> A
A: Transition is a point mutation where replacement of base pair occurs.
Q: calculate the net charge of your peptide at I) pH 2.0; ii) pH 6.0 iii) pH 7.0; iv) pH 11.5. show…
A: Amino acids contain ionizable groups, the ionic form of the amino acids depends on the pH. The…
Q: Which of the following bind to the motif GGAGG in human COLQ gene? SRSF1 hnRNPH Both None
A: RNA is a vital component of the cell that is required for a variety of biological functions,…
How will you prepare 750 ml of the digestion buffer. Show all steps and calculations and remember to explain how exactly you will make it up.
Step by step
Solved in 2 steps
- A buffer contains 0.015 mol of lactic acid (pK₁ = 3.86) and 0.080 mol of sodium lactate per liter. H₂C OH Lactic acid OH Calculate the pH of the buffer. H₂C. Calculate the change in pH after adding 9.0 mL of 0.10 M HCl to 1.0 L of the buffer. O OH Sodium lactate Calculate the change in pH after adding 9.0 mL of 0.10 M HCl to 1.0 L of pure water. O Na+ buffer pH: buffer pH change: water pH change: units unitsRocephin (ceftriaxone sodium) 370 mg IM stat.The label on the ceftriaxone states to reconstitute the 1 g vial with 2.1 mL of sterile water for injection, which results in a strength of 405 mg/mL. How many milliliters will you administer?Calculate the volume of TAE buffer that you will need to prepare a 100ml solution of 1X strength if you only have a 50X concentrated solution available.
- 50X TBE is 87 mM Tris-borate and 4 mM EDTA at pH 8.3. What is the molarity of each of the chemicals in 1X TBE buffer?how many grams of sr(no2)2 are needed to make 200 ml of 0.300M solution of sr(no2)2You are supplied with the following: NaCl (Mr = 58.443 g/mol) 250 mM Tris-Cl, pH 8 solution (1 Litre) EDTA, sodium salt (Mr = 380.2 g/mol) 13 % Sodium dodecyl sulfate solution Proteinase K solution (150 mg dissolved in 1 ml ddH2O) You need a digestion buffer consisting of the following: 23.5 mM NaCl 750 uM Tris-Cl, pH 8 38 mM EDTA, pH 8 1.2 % Sodium dodecyl sulfate 1.75 mg/ml proteinase K Calculate: How will you prepare 750 ml of the digestion buffer? Show all your steps and calculations and remember to explain how exactly you will make it up.
- You are supplied with the following: NaCl (Mr = 58.443 g/mol) 2.5 M Tris-Cl, pH 8 oplossing / solution (1 Litre) EDTA, sodium salt (Mr = 380.2 g/mol) 10 % Sodium dodecyl sulfate solution Proteinase K solution (50 mg dissolved in 1 ml ddH2O)You need a digestion buffer consisting of the following: 15 mM NaCl 75 mM Tris-Cl, pH 8 16 mM EDTA, pH 8 0.8 % Sodium dodecyl sulfate 0.75 mg/ml proteinase KCalculate: How will you prepare 500 ml of the digestion buffer?You just made a 1.5M permanganate solution. What concentration is your potassium permanganate solution in percent? "K: 39.10 g/mole" "Mn: 54.94 g/mole" "O: 16 g/mole" "MW of KMnO4 is 158.04 g/mole" O a. 0.24% Ob. 20.1% O c. 15.8% O d. 23.7% O e. 2%You are supplied with the following: / Jy word voorsien van die volgende: NaCl (Mr= 58,443 g /mol) 2.5M Tris-Cl, pH 8 solution /oplossing (1 Litre) EDTA (Mr= 380,2g/mol) 10% sodium dodecyl sulphate solution / natriumdodecyl sulfaat oplossing Proteïnase K solution / oplossing (50 mg dissolved / opgelos in 1 ml ddH2O) You need a digestion buffer consisting of the following: / Jy moet 'n verteringsbuffer op maak wat uit die volgende bestaan: 15m M NaCl 75 mM Tris-Cl,pH 8 16 mM EDTA,pH 8 0.8% sodium sulphate / natrium dodecyl sulfaat 0,75 mg/ml proteïnase K How will you prepare 500 ml of the digestion buffer? Show all your steps and calculations. Remember to explain exactly how you will make it up. / Hoe sal jy 500 ml van die verteringsbuffer voorberei? Wys al jou stappe en berekeninge. Onthou om te verduidelik presies hoe jy dit sal op maak.
- Calculate pNF concentration in each cuvette using Beer-Lambert’s Law. ε = 18,000 M-1 cm-1; b = 2.00 cm Cuvette 1 pNF 1 mL Water 2 mL Absorbance 0.546A 5% dextrose in 1/2 normal saline (D5 1/2 NS) solution is commonly administered to patients needing post-operative IV fluids. How could you prepare 500 mL of this solution? Dextrose is 5% (m/v) and the NaCl is 0.45% (m/v).How much sodium formate (HCOONa, 68.0069 g/mol) do you need to add to 400. mL of 1.00 M formic acid for a pH 3.500 buffer. Ka = 1.77 x 10¯4