Describe why water is considered to be the most indispensable nutrient. Include a minimum of three (3) specific examples in your answer.
Q: Renata enzymatically conjugates a "C-labeled cysteine to a transfer RNA (IRNA), with a UGU…
A: The genetic codon is the three letter codon that specifies the twenty naturally occurring amino…
Q: What role does superoxide dismutase play in ameliorating the effects of reactive oxygen species?…
A: Superoxide dismutase: This is a very important Enzyme that protects the living cells from harmful…
Q: A positive result for the Ninhydrin test yields a deep blue or violet-blue color of the soluti more…
A: Ninhydrin test is a chemical test performed to detect the presence of amines or amino acids.
Q: Match the best possible fit for the following Animal virus replication stages. A. Attachment B.…
A: Viruses contain nucleic acid/ribonucleic acid in the core region while the exterior/…
Q: Determine the number of carbon atoms present and the the total number of phosphate groups present in…
A: In our body, many metabolic pathways occur. In these pathways, Glycolysis also occurs to convert…
Q: Please explain what happened in the reaction. How did H2SO4 and 3H2O reacted with the glucose?
A: Carbohydrates are polyhydroxy aldehydes or ketones or compounds that yield them on hydrolysis.…
Q: 5. Protein tyrosine phosphatase-1B (PTP1B) is an important enzyme regulating insulin signaling be-…
A: PTP1B enzyme in question catalyze the hydrolysis of phosphorylated tyrosine on Insulin receptor and…
Q: Which among the following correctly represents the characteristics of an anion exchanger O Anion…
A: Ion exchange chromatography a chromatographic method based on the net charge of the protein.
Q: In a reverse phase chromatography set up, the component that yields the lowest Rf value is likely to…
A: Reverse phase chromatography: The chromatographic technique that uses the hydrophobic stationary…
Q: Reactions and Thermodynamics of Glycolysis
A: Third step of glycolysis, fructose-6-phosphate is converted to fructose- 1,6-bisphosphate by…
Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: Design a quantitative research experiment to investigate the influence of pH or temperature on the…
A: Introduction: Enzymes are biological catalysts that fasten the speed of the chemical reaction. They…
Q: Diagram to compare & contrast CATABOLISM vs ANABOLISM such as its process/mechanism, relation with…
A: Anabolism and Catabolism are the two broad type of biochemical reaction in metabolism where…
Q: Succinyl-CoA Synthetase mechanism Succinyl-CoA synthetase enzyme active site O Substrates bind to…
A: Succinyl-CoA-Synthetase: This is an enzyme of TCA cycle catalyze the conversion of Succinyl-CoA to…
Q: Match the following descriptions to the given choices. A. Aldosterone The first molecule in the…
A: 1. The first molecule in the biosynthesis of steroids that contain the…
Q: is used in gluconeogenesis that bypasses step 1 of Glycolysis in the production of free glucose from…
A: Gluconeogenesis is a process that transform non-carbohydrate substrate into glucose.the principal…
Q: Spectrophotometric determination of riboflavin at max 445 nm.
A: When Lab scientists have to be measured total protein by UV-spectroscopy some important things…
Q: What are the steps in extracting DNA from a Banana using simple household materials like dishwashing…
A: DNA extraction from banana is most commonly followed as banana is triploid with three sets of…
Q: Match the following lipids with their functions
A: Lipids are the various organic compounds which are insoluble in water. These are- fats, waxes,…
Q: Which of the following products of the non-oxidative stage of PPP is an intermediate in the…
A: PPP : Pentose phosphate pathway The non-oxidative phase of PPP links the glycolysis to the pentose…
Q: In a single pass through of the b-oxidation pathway, what are products that can be used in a…
A: Introduction: The fatty acids present in our diet or produced through the degradation of…
Q: O dihydroxyacetone-P DHAP ATP ADP ATP ADP glucose-6-P G-6-P fructose-6-P F-6-P glucose…
A: In the diagram glycolytic pathway, pentose phosphate pathway and Leubering- Rapport shunt is given…
Q: if they are true or false? Kindly leave a short explanation. Many thanks! 1. Unlike carbohydrates…
A: A biomolecule, also known as a biological molecule, is one of the many compounds created by cells…
Q: Question 2 You are using molecular modelling software to examine the X-ray crystal structure of the…
A: Beta-Adrenoreceptor: They are GPCR and contain seven transmembrane helices. It is widely distributed…
Q: True or False? a. RNA, DNA, and ATP are important macromolecules, are formed from simple…
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of…
Q: Explain which of the following substances ATP, CoA-SH, FAD and NAD+ have the subunits in their…
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotides is an…
Q: How does NanoDrop quantify DNA?
A: Quantitative analysis techniques are used to measure the quantity of a substance in a solution.…
Q: Phospholipids have ____ fatty acids while triglycerides _____ fatty acids.
A: Lipids are defined as organic substances insoluble in water but soluble in organic solvents like…
Q: Which among the following statements is correct? O lon-exchange chromatography is dependent on the…
A: Introduction: Chromatography is an analytical technique for the separation of different dissolved…
Q: 12 If strong-base anion exchange resin is applied to treat raw water with silicate, the pH of raw…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Outline 3 properties of proteins that can be used in bioseparations and explain how you could…
A: Proteins are macromolecules that are made up of Amino acids. They can be classified as globular…
Q: The 6-member pyranose ring of glucose is formed through the interaction of the hydroxyl group on C5…
A: The carbohydrate glucose can form an intramolecular cyclic hemiacetal.
Q: Draw a linear disaccharide of glucose. is an alternating alpha (1-4) and b (1-4) linkages energy…
A: Introduction:- The question is all about the structure of glucose that are isomers of each other as…
Q: Biochemistry: Diagram the biosynthetic pathway from precursors (like amino acids, PRPP, etc.) to…
A: There are two pathways for the biosynthesis of nucleotides: de novo and the salvage pathways. In the…
Q: Which of the following processes generates the most ATP? (Account for the no. of ATP) a. ) Citric…
A: The human body is a complex system that requires energy to operate effectively. At the cellular…
Q: Why water is polar while carbon dioxide is not?
A: Polar molecules are the molecules with different poles with two different charges. The two different…
Q: Consider the Michaelis-Menten equation, below: Vmar S V. k + [S] %3D What is the relationship…
A: [S] : Substrate concentration V= Vmax[S]/(Km+[S]) Vmax: Maximum velocity Km: [S] at which V is…
Q: 4. What is a "partially hydrogenated vegetable oil"?
A: Oils are nonpolar, unsaturated lipids that are liquid at room temperature. they are hydrophobic…
Q: With the aid of diagrams describe the signalling pathway involving inositol 1,4,5 trisphosphate from…
A: Membrane phospholipids can act as precursors from which second messengers can be produced during…
Q: D Question 6 6. The following table summarizes properties of three different proteins. Two would be…
A: Chromatography is an analytical technique for separating components of a mixture
Q: 5-6. Choose the best answer from the following questions and provide a one paragraph explanation for…
A: RBCs transfer oxygen from the lungs to the rest of the body's cells. This oxygen is needed to…
Q: Make a concept map covering about the following: a. SYPHILIS b. Anti-Streptolysin O Test (ASO TEST)…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: Enzymes accelerate the rate of a reaction by: a. lowering the number of molecules with lower…
A: Introduction: Enzymes are biological catalysts that fasten the speed of the chemical reaction. They…
Q: Determine the pKa of the amino acid using the graph graph attached:
A: Amino acids contain amino group and carboxyl group along with R side chain. The R side chain defines…
Q: During the treatment of hyperlipidemia, what is the metabolism of lipoproteins; and the mechanism of…
A: Hyperlipidemia refers to a high-level blood lipids like cholesterol (non-HDL cholesterol and LDL…
Q: 1-How is a total cholesterol test different from a lipid panel?
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: CH,0-P-O C=0 0. CH;0-P-O CH,OH HO-C-H H-C-OH C-H Ö HO--H ČH,O-P-O- H-C-OH O t. CH;0-P-O
A: Glycolysis is a metabolic pathway of conversion to glucose to pyruvate.
Q: Look at the structure of the disaccharide shown. Name the type of bond which is present. CH2OH H он…
A: Disaccharides exist in more than one chemical conformational structure. The alpha and beta forms of…
Q: what transport proteins are involved is getting ca2+ out of cytosol
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: The process of protein decomposition by pepsin enzymes in stomach is assumed and modeled as a batch…
A: The reaction kinetics given in the pepsin digestion reaction follows Michaelis-Menten Kinetics. The…
Describe why water is considered to be the most indispensable nutrient. Include a minimum of three (3) specific examples in your answer.
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- You are shopping for fertilizer for your new tomato plants in your garden. You have a choice between a name-brand fertilizer and a generic-brand fertilizer, which are both in liquid form. The labels indicate that they are identical in composition (the type of nutrients and their amount per unit volume of fertilizer are identical). The name-brand fertilizer advertises that it is superior to any other fertilizer on the market. To test the claims of the two fertilizers you decide to buy one bottle of each and treat equal numbers of "Big Boy" tomato plants (a single type of tomato that goes great with salads) with the same amount of each fertilizer for the entire growing season. Using the information from the paragraph above, which of the following is an example of a controlled variable in your experiment? A) growing the same type of tomato plant B) using the same amount of fertilizers C) using 2 different fertilizers D) growing the same type of tomato plant and using the same amount of…Discuss the differences between GE (Gross energy), ME (Metabolizable energy), and DE (Digestible Energy). Among the three values, which one is the most accurate estimate of energy value of a feedstuff and why?Read the following article. ASK MR. GREEN: Organic Produce versus Nonorganic Produce Dear Mr. Green: Lately I see more and more "organic" fruits and vegetables in the supermarkets. I'm confused. Often the organic apples or strawberries aren't as red or as large as the other ones. They sometimes have spots or insect holes. And organic produce can cost three times as much as other produce! So, tell me, what exactly are organic fruits and vegetables? And why are they so expensive? Confused Shopper Now Read Mr. Green's answer. Dear Confused Shopper, You're right. Sometimes organic produce doesn't look as nice as nonorganic produce, and it generally costs up to 50 percent more. Let me explain why. Since about 1950, farmers have used chemicals to grow their fruits and vegetables. They use pesticides to kill insects that eat their plants. They use herbicides to kill the weeds that kill their plants. These chemicals are a great help to farmers. By using them, farmers can grow more produce on…
- a macronutrient is a nutrientWhat is the difference between micro and macro nutrients? Justify your answer.Look at the nutrition labels for a Blueberry Nutrigrain Bar and a Blueberry RX Bar, also paying close attention to the ingredient lists provided in each. Answer the following questions: What is the difference between total sugars and added sugars? How do the total sugars and added sugars differ in these two bars? What are the biggest differences in the ingredient lists in these bars? Choose one ingredient that you have not heard of from the list from either bar. Explain to the class what the ingredient is and what its purpose is. https://nam10.safelinks.protection.outlook.com/?url=https%3A%2F%2Fsmartlabel.kelloggs.com%2Fen_CA%2FProduct%2FIndex%2F00859162007606&data=05%7C01%7Ccagoldstone%40post.edu%7C5c810aba920742bceb4008daed908eaf%7C60e34a340d2d47d6b05c6f468fa4cfc6%7C0%7C0%7C638083502374021131%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000%7C%7C%7C&sdata=ULK4f3%2FxWLnZPww%2FDgN63V6ddjoupjsdnIRFPBxkt2w%3D&reserved=0…
- Phosphorus is a mined, nonrenewable resource and comes from phosphate rock. It is second only to Nitrogen as to the amount used by plants. List 3 functions in organisms (plants & animals).WHY ARE CARBOHYDRATES UNIVERSALLY IMPORTANT AS IMMEDIATE ENERGY RESOURCES?Marko is a farmer who raises deer in his ranch. He has 100 female deer age 3–15 months. The deer require 22 MJ of metabolizable energy per day during the spring months. The deer are being fed a mixture of 50% wheat and 50% silage. The wheat contains 85% dry matter (DM) and has 12.5 MJ metabolizable energy per kilogram of DM. The silage has 30% dry matter and 10.5 MJ metabolizable energy per kilogram of DM.a) How many kilograms of feed are required per day to feed the 100 deer?b) Calculate the energy (in MJ) converted to body tissue on a daily basis. Assume that 19% of the feed consumed is excreted as undigested material. Of the remaining 81% that is digested, 78% is used in generating metabolic waste products and heat. The remaining is incorporated into tissue. solve it sap
- What is the difference between micro and macro nutrients? Elaborate your answer.Identify the nutrient: is an antioxidant; animal sources are more reliable than plant sources; deficiency symptoms include night-blindness and trouble tasting/smelling; oxalates and phytates bind to it, reducing absorption from plant foods; is water soluble calcium vitamin A vitamin C iron O zincWhat is misleading about the statement: “Plants produce sugars for the purpose of providing food for animals”.