Q: Trichuris trichiura Ascaris lumbricoides hookworm Enterobius vermicularis
A: This is a diagramatic image of nematode egg. The nematodes, also known as roundworms constitute the…
Q: What is knockdown gene analysis? How is this different from knockout analysis?
A: Gene knockdown is a method in which temporarily stop or decrease the expression of one or more…
Q: Get out a sheet of paper. Hand draw and label the general cell cycle, including all 4 general phases…
A: Cell is the basic building block of life. When an organism grows in size its cells have to divide.…
Q: Explain the advantages of the use of the flexible endoscope for investigation of the…
A: Flexible endoscopes are sophisticated medical tools used to view internal body parts. Endoscopes…
Q: 6. Define which of the following results (pH, HCO³ mmol/l, Pcomm Hg) take place in a patient who…
A: Smoking is a leading cause of preventable deaths worldwide and is linked to a variety of health…
Q: Compare physical and chemical control of microbes and give an example of each.
A: Microorganisms are referred to as that organism that is single-celled and can only be visualized…
Q: Hello, what about if the diagnosis of this is PCP Pneumonia. What are the: 5. Diagnosis and…
A: In healthy individuals, PCP is quite uncommon, but the fungal which generates it may survive in the…
Q: In this diagram, which of the following is TRUE? H H+ (proton). Organic molecule that includes two…
A: Oxidation-reduction (O-R) reactions are very important reactions in cellular metabolism. The…
Q: In guinea pigs, short hair is dominant to long hair. Also in guinea pigs, black eyes are dominant to…
A: This question is asking about the expected phenotypes and phenotypic ratio of the offspring…
Q: Describe post-translational modifications and protein-protein interactions that occur and play role…
A: The IgG1 subclass, which is the most prevalent in human serum, is crucial for triggering immune…
Q: Dihybrid Crosses - Genotypes NOW YOU KNOW THE RULES - FOR EACH PHENOTYPE SHOWN IN THE PICTURES, WORK…
A: Introduction A gene exists in two alternative forms known as allele. When both the alleles are same,…
Q: 4. Which traits are shared by all eukaryotic cells, and what are the three major lines of evidence…
A: Eukaryotic cells are a type of cell that are characterized by a number of unique features, including…
Q: 1.covert 7712 cubic centimeters to liters 2.covert 31.7 quarts to litters
A: Scientific notation is a way of expressing smaller or larger values in a simple form. For example,…
Q: list any three parasites adaptations in plants
A: Introduction: parasitic plant is one that derives all or a portion of its nutrients from another…
Q: Write a brief summary of the Spotted Lantern Fly. Make sure to include it's role and interspecies…
A: Introduction: In Pennsylvania, the Spotted Lanternfly (Lycorma delicatula), which is endemic to…
Q: An experiment was conducted looking at the likelihood to get covid when you are not vaccinated,…
A: The independent variable is the variable that is changed or manipulated by the researcher.
Q: how does genetic engineering help us grow oranges?
A: Genetic engineering is a biological process in which transgenic or genetic modified individuals are…
Q: Fertilized, unfertilized, and mammilated coat eggs of O O Strongyloides stercoralis Necator…
A: Some parasites can also cause severe allergic reactions, such as itching, rashes, and respiratory…
Q: 11. What is the role of photosynthesis that links plants and animals? 12. If the enzyme RuBisCo is…
A: Metabolism is a phenomenon takes place inside the living cell in which formation of large new…
Q: In the Gram stain, gram-positive bacteria are dark purple for all the following reasons EXCEPT: None…
A: Introduction : The bacteria are classified on the basis of staining as gram-positive and…
Q: Suppose that researchers wanted to examine the combined effects of an introduced predator (a trout)…
A: The effect of the parasites and the introduced species on the native species is observed in the…
Q: You have been asked to engineer a protein (which is not an immunoglobulin) that is capable of…
A: Protein engineering is the process of deliberately modifying the structure and/or function of…
Q: how vaccines mediate protection, including the modes of actions, sites of activity, and the immune…
A: vaccine is nothing but a biological preparation which provides acquired immunity to a particular…
Q: Evaluate the nutritional label of a food item, either one in the supermarket or one that you have…
A: This question will evaluate the nutritional label of a food item, specifically potato chips, and…
Q: a) Give one example of where active transport is used within the body and explain the mechanism of…
A: Introduction As we know cell membrane is semipermeable and it allows movement of various molecules,…
Q: Science Toolkit The Guilty Dentist hile biologists use the study of evolutionary relationships…
A: HIV stands for human immuno deficiency virus which is a retro virus responsible for causing AIDS. It…
Q: Differentiate the roles of the 5 different classes of antibodies that comprise the…
A: An antibody, also known as immunoglobulin, is a protective protein produced by the immune system in…
Q: Carbohydrates are classified by The most common simple sugars are glucose, galactose and fructose…
A: Introduction:- Biomolecules are the carbon containing organic compounds, present in the living…
Q: Elaborate Darwin's and Lamarck's theories on evolution in terms of putting its MAIN IDEA, SUPPORTING…
A: Evolution is the gradual change in the inherited traits of biological populations over many…
Q: Question: Suppose the progeny were crossed. Fill in the Punnett Squares below and answer the…
A:
Q: Mrs. Kaur and Mrs. Sharma had babies on the same day at the same hospital. Mrs. Kaur took home a…
A: Introduction : There are four types of blood groups in humans in case of ABO system. These are A,…
Q: In terms of classification, what are the 5 unique characteristics that place animals in the Phylum…
A: Kingdom Animala consist of many phylums. Mollusca is the second largest animal phylum and consists…
Q: HIV research task Use the HIV article to answer the following questions: • When was HIV first…
A: As per Bartleby guidelines, we are to answer a maximum of three subquestions, kindly post other…
Q: Name the connection between the hypothalamus and the posterior pituitary gland. What does it consist…
A: Pituitary gland is an endocrine gland that mainly consists of two lobes called anterior and…
Q: Medium/test Gram stain TSA Eosin methylene blue agar (EMB) SIM motility agar Brewer's plate in…
A: In microbiology, different tests are used to test the presence of various microorganisms. The…
Q: explain what a bootstrap value is and why the information it provides is useful.
A: bootstrap value is the proportion of replicate phylogenies that recovered a particular clade from…
Q: Explain the steps of RNA translation into protein.
A: “Since you have posted multiple questions, we will provide the solutiononly to the first question as…
Q: The adult female nematode is usually smaller than the male. True O False
A: The nematodes or roundworms constitute the phylum Nematoda, with plant-parasitic nematodes also…
Q: Describe the structure of the flexible endoscope.
A: An endoscope is a flexible tube with a built-in camera that enables medical professionals to…
Q: Determine the patterns of inheritance of the following X-linked dominant cases by giving the results…
A: X Linked dominant inheritance means the genes present in X chromosomes, if the gene has dominant…
Q: 88 1 Dihybrid Crosses - Problem 1 WELL STICK WITH PEAS FOR THE FIRST PROBLEMI The allele for round…
A: A dihybrid cross is a cross that involves two characters. Genotypes - Smooth/ round - RR or Rr…
Q: at is meant with the interplay of hormones?
A: Hormones are secreted from endocrine glands. Endocrine glands are ductless glands which secrete…
Q: carcinoma
A: Carcinoma: It is defined as the cancer which arise from the epithelial tissue that lines the inner…
Q: Food going through the human digestive system only moves in one direction in some animals however…
A: The evolution of various kind of digestive system of animals helps them to digest their different…
Q: What are some healthcare policy drivers?
A: Healthcare policy refers to the laws, regulations, and guidelines that govern the delivery and…
Q: 14. In what type of inhibition does the inhibitor bind to an enzyme at a site other than the active…
A: Enzyme inhibition It is the process of rendering the enzyme inactive and unable to function to…
Q: Instructions- DO THE GRAPH LABELING THE NUMBERS AND LABELING THE POINTS AND PLEASE DO THEM ON THIS…
A: The experiment is conducted by taking various variables like independent variables, dependent…
Q: What is the indication that the orange syrup is deteriorating?
A: Food rotting is the procedure through which a product turns into unfit for consumption by the…
Q: A snapdragon plant with violet flowers was crossed with another such plant with white flowers. The…
A: INCOMPLETE DOMINANCE It is a gene interaction in which both alleles of a gene at a locus are…
Q: Which of the following is an important model organism for studying development? a. E.coli O b. D.…
A: Model organisms: When the process of development is studied in detail the model organisms…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
how many
Step by step
Solved in 2 steps
- The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?Below is a sequence of DNA.5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF? How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF? Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortestORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longestORF (from N to C-terminal end)?
- Which of the following RNA sequences is an inverted repeat and can form a stem-loop structure? What is the correct option from the choices below? GGUAGGCAUUACGGAUGG GGUAGGCAUUAGCCUACC GAGAGAGAUUAGAGAGAG GGGGGGGAUUAGGGGGGG GAGAGUGUAAGUGUGAGAWhat amino acid sequence will be generated, based on the following DNA codon sequence? Did you read this question carefully also? Are you certain? (You may list the three letter abbreviations for the amino acids listed below) DNA Sequence: TAC AAG CCC TAG GCG ATA АТС [a] Table 1. MRNA codons & associated amino acids Second base C G UUU Phe UUC UCU UAU UGU U Тyr UAC Cys UGC UCC Ser UCA UAA Stop UGA Stop A UUA Leu UUG UCG UAG Stop UGG Trp G CUU CCU CAU] His CAC CGU CUC C CUA CGC Leu Pro CCA Arg CGA CAA Gin CUG CCG CAG CGG AUU ACU AAU Asn AAC Thr AAA Lys AAG AGU Ser AGC AUC Ile ACC AUA AGA Arg AGG ACA AUG Met or start ACG GUU GCU GAU GGU Asp GAC U GÚC GCC Ala GCA GGC Val GUA Gly GAA GGA Glu GAG GUG GCG GGG G Cooriaht O Pearson Education. Inc Dublishina as Beniamin Cumminas First base (5' end) Third base (3' end)Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’
- This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’The Universal Genetic Code Table can be used to determine the gene product of a given nucleotide sequence. Universal Genetic Code Table Second Letter A G UUU } Phe UCU UAU } Tyr UGU } Cys UUC UCC UAC UGC Ser UUA } Leu UCA UAA STOP UGA STOP UUG UCG UAG STOP UGG Trp CUU CAU CCU CCC CGU } His CUC CAC CGC Leu Pro Arg CUA ССА CAA CGA } Gin CUG CCG CAG CGG AGU } Ser AUU ACU AAU } Asn AAC AGC AUC A AUA Ile ACC Thr ACA AAA AGA } Lys } Arg AUG Met ACG АAG AGG GUU GCU GAU GGU } Asp GUC GCC GAC GGC Val Ala Gly GUA GCA GAA GGA } Glu GAG GUG GCG GGG The table below represents the transcription of a short peptide sequence in a human cell. Place the amino acid abbreviations that correspond to the nucleotide sequence when it is translated. DNA TTG CTG TGT GAG GCA MRNA AAC GAC ACA CUC CGU Protein (реptide sequence) :: Ala :: Arg : Asp :: Asn :: Сys : Gln : Glu : Gly :: His : lle : Leu : Lys : Met : Phe :: Pro :: Ser :: Thr : Trp : Val Third Letter First Letter
- Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG Part of a sequence of DNA from a person with a genetic disease is: TAG TAA CCA CCC AGG The possible codons for some amino acids are shown in the table. Amino acid Codons glycine GGU GGC GGA GGG isoleucine AUU AUC phenylalanine UUU UUC serine UCU UCC UCA UCG Which amino acid is missing from a person with this genetic disease? serine glycine O phenylalanine isoleucineThe DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'Which of the following single-stranded DNA sequences is most likely to form a stem-loop structure? GGATCACGTTACCGCC TCATAGGCGCCGTTCA TAAGTACATTACCCCG GACCGTATGCACGGTC