Which of the following single-stranded DNA sequences is most likely to form a stem-loop structure? GGATCACGTTACCGCC TCATAGGCGCCGTTCA TAAGTACATTACCCCG GACCGTATGCACGGTC
Q: Which form of fructose ,alpha or beta does take part in most biochemical reactions
A: Two-dimensional representation of cyclic structure of monosaccharides are called Haworth projection.…
Q: xplain the indirect effect that allosteric effectors have on pyruvate dehydrogenase activity through…
A: The pyruvate dehydrogenase complex acts a a connection between glycolysis, the tricarboxylic acid…
Q: A first year BS Nursing was given an unknown carbohydrate that could be any of the following:…
A: Iodine test is a qualitative test for carbohydrates. In the iodine test, the polyiodide ions react…
Q: How can RNA sequencing (RNA-Seq) and Mirccorays in Transcriptome analysis find disease genes? Please…
A: Researchers can describe the transcriptional activity (coding and non-coding), concentrate on a…
Q: In a Myoglobin and azide ligand-receptor binding experiment, instead of using 3.5 µM myoglobin you…
A: Myoglobin acts as oxygen reserve in the muscle cells. Myoglobin (Mb) has higher affinity towards…
Q: How can an understanding of enzymes and biological receptors guide medicinal chemists? Match the…
A: It was long recognized as a differentiating feature of both drug and receptor, the selectivity of…
Q: Calculate the ∆G°' for the complete oxidation of acetate (C2H3O2-) to CO2 by: a) aerobic metabolism…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…
Q: KINETIC CONSTANT No Na2HPO4 25mM Na2HPO4 50mM Na2HPO4 Vmax nmol p-NP. Min- 20.3252 14.30615 17.30104…
A: Active site is the site where a substrate molecule binds with an enzyme. The binding between a…
Q: Consider the following reaction occurring at 298 K: OH CH₂OH OH -0. OH +ATP OH k₁ k₂ 0- -0-CH₂ to OH…
A: Biochemical reactions tend to be slow because biomolecules are stable at biological pH and…
Q: What is the function of sodium dodecyl sulfate (SDS) in SDS-PAGE? stabilizes the gel matrix,…
A: Electrophoresis means migration of charged particles under the influence of an electric field.…
Q: The following scheme shows how acetylcholine esterase (AChE) enzyme hydrolyzes acetylcholine (ACh).…
A: A cholinergic enzyme called acetylcholinesterase (AChE) is mainly present in postsynaptic…
Q: Which of the following correctly matches the chromatography technique with the molecular property…
A: Chromatography is a laboratory technique for the separation of a the components that are present in…
Q: A geneticist is trying to determine how many genes are found in a 300,000 bp region of DNA. Analysis…
A: The question mentions that the geneticist is trying to figure out the number of genes that could be…
Q: What is the smallest number of molecules of ATP and GTP consumed in the synthesis of a protein with…
A: The process of gene expression requires two steps: transcription and translation. Translation is the…
Q: Consider the oxidation of a molecule of MANNOSE. (Put the numerical values in the answer boxes.) •…
A: Mannose is a carbohydrate that is composed of carbon, hydrogen, and oxygen in a ratio of 1:2:1.…
Q: BIOC 384 What would be the long-term effects if ATCase remained in the inactive T state?
A: ATCase(aspartate transcarbamoylase) is an allosteric enzyme that participates in the pyrimidine…
Q: In the tertiary structure of a protein, glutamine can interact with O valine; hydrophobic…
A: Proteins are bio molecules with vast diversity in their structure. They exhibit four levels of…
Q: Proteins destined for the peroxisomes can be translocated in their functional shape. True False
A: Protein targeting is a biological process by which the cells localize the proteins in different…
Q: The net energy requirement for translation of a 4 amino acid long polypeptide chain in terms of ATP…
A: The process of gene expression requires two steps, transcription and translation. During…
Q: HO -NH₂ NH NH HN S-CH3 ΝΗ O The peptide chain has OH residues. The name of the peptide using single…
A: Peptides are small sequences of amino acids that are joined together through peptide bonds. Peptides…
Q: The following are coenzymes or cofactors involved in enzymatic reactions. Identify the biochemical…
A: Enzymes are biological catalysts that increases the rate of biochemical reactions. Most enzymes are…
Q: How many of the following statements are true? Allosteric enzymes display sigmoidal kinetics for…
A: Allosteric enzymes are enzymes that possess additional binding sites known as allosteric sites.…
Q: Fructose 1,6-bisphosphatase (FBPase) is a key enzyme in gluconeogenesis. The mammalian enzyme is…
A: Gluconeogenesis is a process in which glucose is synthesize from non-carbohydrate sources like…
Q: Draw the catalytic triad of a serine protease at the first tetrahedryl intermediate stage. Your…
A: Serine proteases cleaves peptide bonds of protein substrates. They are called serine proteases…
Q: what experiment can be used to confirm that agglutination was due to the binding of the lectins to…
A: Lectin is the collective name for all sugar-binding proteins. Lectins have one or more than one…
Q: An uncompetitive inhibitor interacts with the enzyme•substrate complex to form a ternary complex…
A: Enzyme inhibition is a process by which the activity of an enzyme is altered. Inhibitors are…
Q: 2. The Km of a particular enzyme is 2.0 x 105 M. If the initial velocity (Vo) is 0.16 mmol/min for…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: Draw the following Lipids in: A) Condensed (detailed) Structure, B) its Block Diagram. C)…
A: A sphingosine , stearic acid and D-galactose would condense to form a sphingolipid. Sphingolipids…
Q: Can you write possible mineralization and biotransformation reactions for glucose (C6H12O6) ?
A: Biotransformation is the biochemical process (metabolism) taking place in some life form that alters…
Q: Amino Acid Biosynthesis Q7.2: Describe the biochemistry behind RoundUp Ready crops, i.e., what is a…
A: The first Roundup Ready crops were genetically modified soybeans developed in 1996, that were…
Q: Definition of carbohydrate metabolic disorder. introduce other carbohydrate disorders along with…
A: Introduction: The term metabolism is the process by which our body makes energy from the food that…
Q: Below is the skeletal formula of a molecule typically found in cell membranes. What type of molecule…
A: The biological membrane that surrounds a living cell is called the cell membrane. The structure of…
Q: 1. Calculate the initial velocity (Vo) of a Michaelis-Menten reaction as a fraction of Vmax when [S]…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: 67. Purified water contains not more than 10 ppm of total solids. Express this concen- tration as a…
A: PPM is an abbreviation for "parts per million" and it also can be expressed as milligrams per liter…
Q: In the enolase reaction, the Lys 345 and Glu 211 residues participate in the reaction to convert…
A: Enolase is an enzyme which catalyzes the conversion of 2-phosphoglycerate to phosphoenolpyruvate.…
Q: 1. Which of the following pathways of information flow has never been observed on Earth? chose all…
A: Note: Hi! Thank you for the question. We are authorized to answer one question at a time. Since you…
Q: Look at this molecule and determine the number of molecules created from B-Oxidation: FADH2, NADH +…
A: Beta-oxidation is the process of degradation of fatty acids, in order to synthesize energy during…
Q: 4. An enzyme-substrate complex has a Kg = 100 nM. A competitive inhibitor with which of the…
A: KD (Dissociation constant) is the amount of ligand molecules that is required to fill the binding…
Q: Initiation of transcription in prokaryotic cells requires not only RNA polymerase, but also an…
A: The sites of transcription on the DNA has three main regions viz., promoter region (upstream of the…
Q: ) How many moles of ATP can be gained from the catabolism of the following substrates to pyruvate?…
A: Since you have asked multiple questions with multiple subparts, we will solve the first question for…
Q: Ecol sticky end Putl SAATTCCTGCAGAAGCTT CITAA Synthetic polyliner Hindi N&CL Plasmid cloning vector…
A: The Enzyme Commission Number (EC Number) is a numerical classification for enzymes which is based on…
Q: Align two sequences: horizontal - GGAATGG, vertical – ATG, m = 1, mm = 0, g = -1. Use the table…
A: Global Alignment: It is a bioinformatics algorithm used to align protein or nucleotide sequences. A…
Q: Beta subunit of ATP synthase is currently in its loose state. At what phase of ATP synthesis is it…
A: ATP synthase is an enzyme belongs to the class of ligases which catalyzes the formation of ATP from…
Q: First image contains the respective absorbance readings of the samples specified in the 96-well…
A: Protein concentration of unknown sample could be calculated by plotting the graph for standard…
Q: During vigorous exercise, lactic acid is produced in the muscles. When it is moved into the…
A: Introduction: Acid-base balance is the regulation of hydrogen ions. Carbon dioxide is the major…
Q: Define optimum pH and temperature of an enzyme. 2. How do changes in pH and temperature affect the…
A: Enzymes are biological catalysts that increases the rate of biochemical reactions. Most enzymes are…
Q: What technique seperates proteins based on their ionic charge?
A: Proteins are high molecular weight polymers of amino acid residues, linked via a peptide bond. Amino…
Q: When k2 >> k-1, KM approximates the affinity of the enzyme•substrate complex. The (circle one)…
A: Km is also known as Michaelis constant. It is named after German biochemist Leonor Michaelis. It is…
Q: receptor/s b. the energy source c. if there is signal peptide cleavage or none E. Mitochondrion…
A: Major proportion of the mitochondrial proteins are encoded by the nuclear genes. These proteins are…
Q: The main stages of catabolism of biomolecules: proteins, carbohydrates and lipids.
A: Catabolism is the degradative pathway. It deals with the breakdown of complex molecules into simpler…
Step by step
Solved in 3 steps
- This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.In the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash between each group of three bases. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGGAssume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same.…
- Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: bottom strand is the noncoding strand). 5'-ААCGCATGAGAAAGCCCCCCGGAAGATCACСТТСCGGGGGCТТТАТАТААТТАGC-3' 3'-тTGCGTACтстттCGGGGGGCCTTCTAGTGGAAGGCCCCCGАААТАТАТТААТтCG-5' (i) Draw the structure of hairpin loop that will be formed during transcription. (ii) Illustrate how the hairpin loop structure initiates the termination of transcription.
- The sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene. 123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3 a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write the DNA sequence of the mutant gene (Both DNA strands) c. Write the sequence of mRNA produced from the mutant gene d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.Convert the following DNA sequences to RNA sequences.Sequence # 1: CCGGTTCAGGCTTCACCACAGTGTGGAACGCGGTCGTCTCCGGCGACCSequence # 2:CTAAGGTTGCTAATCTCAGCGCTCCGCTGACCCCTCAGCAAAGGGCTTGSequence # 3:GCTCAATCTCGTCCAGCCATTGACCATCGTCGAGGGGTTTGCTCTGTTACSequence # 4:CAAAACGAAATCGAGCGCCATCTGCGGGCCCCGATTACGGACATCAGASequence # 5: TCCAACTCGGGGTCCGCATCGCTCCGCCGGCGACCGACGAAGTTCCGAConsider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-Tyr
- The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all 5 groups and translate. Group A 5’-GGCAATGGGTTTGTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTTTCAAAAATTAAG-5’ Group B 5’-GGCAATGGGTTTGTGAAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACTTTAAGATTTTCAAAAATTAAG-5’ Group C 5’-GGCAATGGGTTTGTGCAATTCTAAGAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTCTCAAAAATTAAG-5’ Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAG1) What DNA base sequence is complementary to the following DNA sequence?TAGCGTGCATGGTGCTTAAC2) What RNA base sequence is complementary to the following RNA sequence?UAAUAGCUUGCUGAUThe following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all groups and translate. FIND THE POSSIBLE MUTATIONS Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAG