You are working with a dog breeder to produce a litter of puppies from their dogs. Of particular interest to this breeder is the texture of the coat and the presence of spots. The texture of the coat is controlled by one gene (R = rough coat, r = smooth coat), and the presence of spots is controlled by a separate gene (S = spots, s = solid coat). The breeder decides to perform the following cross: RrSs x rrSs What percentage of the offspring would you expect to have the following phenotypes: Rough and spotted: Incorrect answer: 56.25% Rough and solid: Incorrect answer: 18.75% Smooth and spotted: Incorrect answer: 18.75% Smooth and solid: Incorrect answer: 6.25%

Q: Some Traits in Garden Pea Plants In pea plants, the genes for seed shape, seed colour, and plant…

A: The method GREGOR MENDEL described as a cross to identify the hidden characters is known as a…

Q: Discuss the costs and benefits of allomothering behavior, and describe the conditions under which…

A: Allomothering behaviour when any other mother of the group continues to take care of the Infant.…

Q: Mitochondrial replication and segregation Transmitted only by the mother Affected organs: muscles…

A: Mitochondria are organelles found in the cells of all eukaryotes. They are often referred to as the…

Q: Livingstone Ⓒ BIODIDAC 964/96

A: The question asked is to label the given diagram. First of all let us find out which animal's…

Q: Relaman has suffered from high fever and Doctor diagnosed it as Typhoid which microorganism infected…

A: Typhoid It is an infection that spreads through the consumption of contaminated food and water.…

Q: Explain how Ethnic Origin (regional ancestry) can be determined from bone but not “Race”. Explain…

A: Answer : Ethnic Origin (regional ancestry) can be determined from bone but not “Race” by clearly…

Q: Assume two alleles A1 and A2 with known frequencies e.g. p (A1) = 0.7, q (A2)= 0.3 What would be…

A: There is single gene. It has two alleles: A1 and A2. The allelic frequency of A1: 0.7  The allelic…

Q: Can you help? I cannot seem to figure out all of the correct answers. I know lysis and budding is…

A: Cell lysis or budding both are processed for reproduction. Viruses can multiply by cell lysis and…

Q: Meiosis only takes place in which cell? A) skin cells B) gametes © C) nerve cells D) all cells

A: ANSWER) Meiosis type cell division is the division of cells which the 4 identical cells are formed…

Q: In classical Mendelian genetics, how can one check the genotype of a parent (A) expressing the…

A: Allele can be defined as an alternative form of gene.Dominant allele is an allele which hides the…

Q: Describe an experiment that shows if early mouse embryo inner cell mass cells containing…

A: An experiment that demonstrates whether the inner cell mass of an early-stage mouse embryo contains…

Q: Tick all the essential steps to demonstrate a genetic linkage between a disease and a molecular…

A: Genetic linkage is the tendency of certain genes to be inherited together due to their location on…

Q: Which of the following statements about carcinomas, which are tumors derived from epithelial cells,…

A: Normally, epithelial cells are a kind of cell which are found on the exterior surface of our skin as…

Q: Why is TP53 called the Guardian of the genome?

A: Instructions for producing a protein known as tumour protein p53 are found in the TP53 gene (or…

Q: Polydactyly is a condition characterized by extra fingers and/or extra toes. It is caused by the…

A: An experiment known as a test-cross involves determining the genotype of an organism that is…

Q: In flies, long wings (W) are dominant to short wings (w). Two homozygous recessive are crossed.

A: Genetic inheritance is the process of transfer of gene from the parent to progeny  Factor affecting…

Q: Targeted metagenomics is helping researchers better understand the complex connectios between diet,…

A: As we can see in the pie charts that Bacteriodetes make 35.44% in patients without cekiac disease…

Q: Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what…

A: Introduction  The process by which a gene's information is used to produce either RNA molecules that…

Q: For each experimental set up (geotropism and phototropism), identify the  dependent and independent…

A: In an experiment the independent variable is the cause and the dependent variable is the effect. The…

Q: In low to middle-income countries, the risks of disease from environmental factors are high for…

A: Low- and middle-income nations bear a disproportionately large portion of the burden of diseases…

Q: not appropriate to self-diagnose outside of a medical context and this is a completely hypothetical…

A: Foot rash can occur as a result of an allergic reaction or infection. For example in athletes food…

Q: VNTR markers: 0 ☐ 0 are usually detected by DNA sequencing are the first used by forensic services…

A: VNTRs (Variable number tandem repeats) also referred to as microsatellites or simple sequence length…

Q: What is the mass transfer by diffusion for t:slim insulin pump ?

A: introduction t:slim insulin pump is designed by micro delivery technology.  it This product costs…

Q: Identify the parts in these plant and animal cells. Human cheek cell, 400x Outermost layer Animal…

A: Image in left upper corner: As human cheek cell is an animal cell, the organelle that contains DNA…

Q: 21. Of the following which act as keystone species: A. Starfish B. Reef building coral C. Long leaf…

A: Keystone species are the first inhabitants of a particular ecosystem. They are important for other…

Q: Put the steps of the process of signal transduction in the order they occur (hint - try to decide…

A: The receptors have site for binding of specific ligand. The receptors are of two types: Membrane…

Q: State how the distribution of hunchback protein changes after fertilization.

A: The uniparental inheritance of organ genomes, protoplasmic components, symbionts, chemicals, and…

Q: If you perform a Chi-Squared analysis and determine that your result is greater than the critical…

A: Ans: Chi- square analysis is a statistical hypothesis test to determine the relationship between the…

Q: What are some factors which may limit the accurate study of soil microorganisms?

A: Archaea, bacteria, fungus, and protozoa are some of the microorganisms found in soil. In addition to…

Q: Cytotoxic T Cells attack O pathogens, rapid growth and division O pathogens, apoptosis (cell death)…

A: Introduction Immunity is defined as the ability of the body to fight against the pathogens. There…

Q: What is meant by a cell cycle checkpoint? -What is its importance? -How does a cell stop it's…

A: Cell cycle refers to the formation of cell from cell. It is quite a complex process that requires…

Q: question: Can you summarize and explain for me what you want to tell in the article below? Can you…

A: Several strategies, including (a) designing infection-safe personal protective equipment (PPE) to…

Q: List the three events that occur during the process of photosynthesis. Explain the role of stomata…

A: Introduction  Plants absorb water (H2O) and carbon dioxide (CO2) from the soil and atmosphere during…

Q: Use the following information to answer the next question. Some Events that Occur During Meiosis 1…

A: There are two kinds of cell division: mitosis and meiosis, mitosis is the most common way of making…

Q: Sometimes, genetic make-ups do not show up as traits. Let us assume Jane has beautiful brown eyes.…

A: Given:  Phenotype of Jane's father - blue eyes. Since her father has pure bred blue eyes, he is…

Q: The cell cycle checkpoint in G2 is utilized to detect ... Select an answer and submit. For keyboard…

A: The cell cycle checkpoint is a control point in the cell cycle, where cells pause and check to make…

Q: Label

A: We know that the male urinary system consists of glands, ducts, and supporting structures. The most…

Q: Which of the following is luminous? ⦁    Star ⦁    Bird ⦁    Cup ⦁    Bat ⦁    Stapler

A: Our solar system consists of several planets revolving around Sun. When we look above in the sky we…

Q: How are the molecular interactions between Hoxd13 and Hoxd11 and Shh and Gli3 in the limb similar?

A: "Hoxd 13 is protein coding gene"  that play's critical role in limb development. If Hoxd 13 has…

Q: Which of the following statements is not true about heritability? a. H^2 is always a number between…

A: Estimation of a trait's heritability is particular to one population in a particular setting, and it…

Q: Please name any five characteristics of the human eye that contribute to its ability to capture…

A: The human eye is a sensory organ that responds to visible light and is a component of the sensory…

Q: Compare and contrast how the endocrine and neural systems do long- distance communication within the…

A: Disclaimer: Since you have posted multiple questions, we will provide the solution only to the first…

Q: In order to metabolize ethanol, the liver uses a pathway that involves alcohol dehydrogenase and…

A: Alcohol metabolism results in increased NADH, which decreases the activity of pyruvate dehydrogenase…

Q: What are the different anatomical joints used in a block start for a sprint? What is happening at…

A: Sprint athletes brace their feet against starting blocks at the beginning of a race to prevent them…

Q: Describe 4 ways that tend to distinguish each of the following taxonomic groups: all primates from…

A: Taxonomic groups are the hierarchical categories used to classify living organisms. These groups,…

Q: QUESTIONS 1. Using a reference, find the function of simple cuboidal epithelial tissue in humans and…

A: Simple cuboidal epithelium is a type of epithelium that consists of a single layer of cuboidal…

Q: An allergy can best be defined as ______. A) a component of the humoral response B) an exaggerated…

A: The function of the immune system is to protect from foreign substances. Hypersensitivity is a…

Q: Which of the following are absorbed into epithelial cells of the intestinal villi, but not into the…

A: When you consume food, the digestive system breaks "down protein" into "individual amino acids."…

Q: Some groups of bacteria can go dormant during periods of environmental stress through the formation…

A: Under stressful environments, some single-cell organisms like bacteria undergo a period of dormancy…

Q: Match each component of the immune system that we studied to its role in defending you against…

A: There are mainly two type of immunity; innate immunity and adaptive immunity. Innate immunity also…

Environmental health and hazards

An organism's environment is the environment in which it lives and has an impact on its well-being. The World Health Organization (WHO) defines environmental health as "those aspects of public health, such as quality of life, that are influenced by physical, chemical, biological, social, and psychosocial components in the environment." Environmental health is concerned with both natural and man-made settings in order to enhance public health. Environmental science, occupational medicine, toxicology, and epidemiology are the key subdisciplines of environmental health.