During the process of genetic transduction in bacteria, two living cells exchange segments of theirDNA.TrueO FalseMacBook AirDIIDD吕0000F9F6F7F5F3F4*&23$8.45YER

Transduction Unlike transformation in which the naked DNA is transferred in Transduction DNA is…

Answered: During the process of genetic…

Science

Biology

During the process of genetic transduction in bacteria, two living cells exchange segments of their DNA. O True O False

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter17: Metabolism: An Overview

Section: Chapter Questions

Problem 13P: What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome...

See similar textbooks

Related questions

Q: Because the two strands of DNA are complementary, the mRNA of a specific gene can be synthesized…

A: DNA stands for deoxyribonucleic acid which is a genetic material pass from one generation to next.…

Q: The basis for the 1-pot DNA sequencing method (discussed in the lecture) is use of ddNTPs…

A: A fluorophore is a fluorescent compound that has the property of re-emitting light when light falls…

Q: The only way that information is extracted out of DNA is through the transcription of MRNAS that…

A: According to our guideline we can answer only the first question. So upload the second question…

Q: An alteration in the DNA from an CG base pair to a AT base pair is called a Select one: O a.…

Q: DNA fingerprinting compares between different individuals. differences in fingertip cells O…

A: Deoxyribonucleic acid (DNA) fingerprinting is an analysis used to identify individuals and to…

Q: DNA microarrays (gene chips) are only capable of monitoring the expression of one gene at a time. O…

A: DNA microarray ( gene chips) are only capable of monitoring the expression of one gene at a time.…

Q: What is the expected frequency of the restriction site 5′−GGCC−3′ in a genome? A. Once every 4…

Q: What is usually the cause for the insertion of long nucleotide repeats O A hairpin that forms on the…

A: DNA polymerases are a group of enzymes that are involved in the synthesis of DNA during DNA…

Q: The -10 and -35 sequences in E. coli DNA are referred to as untranslated region. T/F

A: Transcription is defined as the synthesis of mRNA from the template strand of DNA by the action of…

Q: The cells of many eukaryotic organisms have highly specialized systems that specifically repair G–T…

A: Introduction Repair mechanisms exist to maintain genome integrity and stability in organisms. The…

Q: TEIIB O contacts the DNA at the BRE will bind only if TFIID is bound O is the third factor to bind…

A: TFIIB is a transcription factor that helps to initiate the process of RNA polymerase II production.…

Q: Tautomeric shifts can generate mutations by causing base pairing changes öf nu polymerase is adding…

A: Mutations can be considered as any sudden heritable changes that occur in the genetic material of an…

Q: X-ray exposure often leads to DNA damage such as double strand breaks which is categorized as a type…

A: An individual's bodily design is determined by DNA. The DNA that is passed down from parents to kids…

Q: You are in the lab, and you wish to repeat Avery's experiments. Which of the following mixtures…

A: Avery, Macleod, and McCarty performed an experiment to prove what is the genetic material in living…

Q: Most of the inherited changes in our DNA arise because of exposure to extracellular mutagens,…

A: Answer: DNA is the Deoxyribonucleic Acid is the molecule composed of two long polynucleotide chains…

Q: Since all cells of an organism have same genome they have also same function and structure. Lütfen…

A: Cell is the basic unit of life. According to their number cells can be multicellular and…

Q: Which type of mutations are the least harmful to an organism? * O Duplication Substitution O…

A: Mutations are sudden changes in the DNA sequence and lead to several new characteristics in an…

Q: The proteins and other substances that bind to the DNA rely mostly on non-covalent interaction to…

A: This statement is true. The proteins binds to DNA are of two types the histone and the non histone…

Q: RNA polymerase synthesis in a 5-3 direction O Gene is switched ON O Gene is switched OFF O Does NOT…

A: Transcription is the process of synthesis of an RNA molecule from the template strand of the DNA…

Q: What was the purpose of the random hexamer primers? O primer for GoTaq O amplify the MRNA O primer…

A: Primer These are the short nucleic acid sequences that are are helpful in providing an initiator…

Q: The Genome of an organism is the same in all cells, whereas the transcriptome is different among…

A: A transcriptome is the full range of messenger RNA, or mRNA, molecules expressed by an organism. The…

Q: Can you please answer number 28 and 29

A: Any alteration in the genome’s nucleotide sequence is called a mutation. Any agent that results in a…

Q: Reverse transcriptases are RNA-dependent DNA polymerases that use deoxyribonucleotides as…

A: Reverse transcriptase is the enzyme which is used by viruses such as HIV for the purpose to…

Q: Similar to prokaryotes, eukaryotes have a topoisomerase-ll-class enzyme called DNA gyrase, which can…

A: Topoisomerases are enzymes that catalyze the overwinding or underwinding of the DNA. This issue is…

Q: The selection of the clones in plasmid-based directed mutagenesis depends on O a. Replication error…

A: NOTE: AS PER OUR GUIDELINES WE ARE ONLY SUPPOSED TO ATTEMPT THE FIRST QUESTION, PLEASE RESUBMIT THE…

Q: In the cell, DNA polymerase I replaces nucleotides O a. to the 5' end of the RNA primers of the…

A: DNA replication is a complex process in which the two strands of DNA double helix are separated, and…

Q: Which of the following genetic mechanism isn't used by bacteria in the transference of genetic…

A: *NOTE: Kindly repost for other question Dear Student as per the guidelines we are supposed to answer…

Q: Which type of mutations are the least harmful to an organism? O Duplication O Substitution O…

A: Mutations are the sudden changes of DNA sequence and lead to several new characteristics in an…

Q: DNA pol I O is a single subunit enzyme has a 5' to 3' exonuclease activity has a 3'to 5 exonuclease…

A: DNA polymerase I is a single polypeptide chain consisting about 928 amino acids and has 109 kDa…

Q: In DNA, guanine pairs with cytosine. Select one: O True O False

A: Step 1 Hello. Since you have asked multiple questions, we will solve the first question for you. If…

Q: Once the RNA primers are replaced the fragments in the lagging strands are sealed by DNA pol I. A…

A: The replication is the process of producing double standard DNA molecule from the parental double…

Q: G. Aureliano has a mutation in the blue-shaded nucleotide in the TEMPLATE DNA sequence. Instead of a…

A: Introduction :- A mutation is a change in our DNA sequence that happens as a result of errors in DNA…

Q: Human genome's gene-rich areas are predominantly composed of A and T nucleotide bases. Lütfen birini…

A: Gene rich region is defined as the region which contains more than 15 genes per MB and gene poor…

Q: The following nucleotide sequence is found in a short stretch of DNA: 5′–AG–3′ 3′–TC–5′ a. Give all…

A: the genome is never a static entity, it constantly undergoes changes in its sequence either due to…

Q: RNase H will remove ribonucleotide directly linked to the DNA end. True false

A: The capacity of nucleic acids to guide their own reproduction from monomers makes them unique.…

Q: The chloroplast can make its own proteins by the process of translation Select one: O True O False

A: Ans- False

Q: Human Genome Project was publicly and privately funded project and took 13 years from 1990 to 2003.…

A: DNA that determines the genetic information of a given organism. In other words, genetic make-up of…

Q: Which of the following is true of transposons? O A) SINES are DNA-only transposons O B) LINES are…

A: Transpositional recombination is a process where the transposing DNA segments or elements are…

Q: An interaction between a protein and a fragment of DNA has a AG° = -42.8 kJ/mol. What can we say…

A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the…

Q: In regards to satellite DNA, the major difference between a LINE sequence and a SINE sequence is the…

A: In molecular biology, there are two types of genes ,coding and noncoding. Coding genes helps in the…

Q: A certain section of the coding (sense) strand of some DNA looks like this: ATGCTAGAGTGA It's known…

A: Given: Coding strand: 5'-ATGCTAGAGTGA-3' So we have, Template strand: 3'-TACGATCTCACT-5' The mRNA…

Q: The ends of the linear chromosomal DNA are protected from degradation and gradual shortening by the…

A: The hereditary unit of the life is the genes. These genes are present in a long thread like…

Q: Since we have many different repair mechanisms, the loss of any one repair mechanism won't cause any…

A: DNA repair involves the set of processes involved in the correction of the damage caused to the DNA…

Q: The SOS response in bacteria is a type of repair that only occurs under extreme conditions when DNA…

A: The SOS response in bacteria, which has been widely investigated in Escherichia coli, is a worldwide…

Q: Gene cloning vectors should have the property of self-replication so that DNA insert can be copied…

A: Cloning means to make copies in large amount of the cell which have the same genetic make i-e the…

Concept explainers

Genetic Recombination

Recombination is crucial to this process because it allows genes to be reassorted into diverse combinations. Genetic recombination is the process of combining genetic components from two different origins into a single unit. In prokaryotes, genetic recombination takes place by the unilateral transfer of deoxyribonucleic acid. It includes transduction, transformation, and conjugation. The genetic exchange occurring between homologous deoxyribonucleic acid sequences (DNA) from two different sources is termed general recombination. For this to happen, an identical sequence of the two recombining molecules is required. The process of genetic exchange which occurs in eukaryotes during sexual reproduction such as meiosis is an example of this type of genetic recombination.

Microbial Genetics

Genes are the functional units of heredity. They transfer characteristic information from parents to the offspring.

Question

During the process of genetic transduction in bacteria, two living cells exchange segments of their
DNA.
True
O False
MacBook Air
DII
DD
吕0
000
F9
F6
F7
F5
F3
F4
*
&
23
$
8.
4
5
Y
E
R

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

ABO blood group system is defined by the presence of agglutinogens (A and B molecules) at the surface of red blood cells. Enzyme A which leas to the production of the molecule A is coded by all ele A, while enzyme B which leads to the production of the molecule B is coded by allele B, and enzyme O which cannot lead to the production of any molecule is coded by allele O. A part of the coding DNA strand for enzyme A: GAC GTG CGC GCC A part of the coding DNA strand for enzyme B: GAG GTG GcC GCC 5. Compare the non-transcribed strand coding for enzyme A to that coding for enzyme B. 6. Identify the type of mutation involved in this case. Justify. 7. Write the amino acid sequence for both enzymes. 8. "Mutations can lead to diseases or to genetic diversity"Justify by refering to parts A and B. Second letter A G UCU UCC UCA UUG Leu ucG UUU T Phe UUC UAU1- Tyr UACJ Ser UAA Stop UGA Stop UGU), UGCJ UUA UAG Stop UGG Trp CAUTHIS CCU CC CCA CCG CUU CÚC CÁCJ Pro CAA CGU] CGC Arg FLeu CGA CGG CỦA Gln…
Table I CACGT A GA CTGAGG ACTC CACGTAGACTGAG G ACAC Wild-type beta-globin gene fragment Sickle-cell beta-globin gene fragment > Circle the mutation in DNA of the sickle-cell beta-globin gene fragment Compare fragments of DNA the wild-type and mutant beta-globin genes in the Table I above, what are the similarities and differences you observe?
(i) For the chromatogram below, what is the sequence of the template DNA from base 115 to 125? CTGTGTGAAATTGT TA T CCGC T CA CA AT T C CACA CA A CATA CGAGC CGGAAG CA TA A 110 120 130 140 150 160 (ii) An allele of a gene has the following change in it's sequence ATG GTG CÁC CTG ACT CCT GTG GAG AAG TCT compared to the wild type ATG GTG CAC CTG ACT CT GAG GAG AAG TCT With reference to the sequence; there is a codon, resulting in a change from is a mutation in the to which mutation.
1.0 MS2 T4 E. coli 0.5 104 103 102 10- 10' 102 103 10* 1 Cot (mole x sec/L) b.) This next figure compares the DNA from two bacteriophages (MS2 and T4) and a bacterium (E. coli). The genome sizes are as follows: MS2 3569bp; T4 168, 903bp; E. coli -~4. 600, 000bp. i. Describe the relationship of the three different curves to each other. ii. Explain this relationship in terms of genome size. c.) When half of the DNA in the sample is double-stranded, that point is termed the half- reaction time (Cot12). Plot a graph below that describes how genome sizes of MS2, T4 and E.coli affects the half-reactioh time. Fraction remaining single-stranded (C/Čo)
#3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Describe the term SDS-PAGE.
For the chromatogram below, what is the sequence of the template DNA from base 115 to 125? CTGTGTGAAA TTGT TA T C CGC T CACA A T TCCACA CA A CATACGAG CCGGAAG CA T AA 110 120 130 140 150 160 СТТТААСАAТА ТАTTCAATTТС ATAACAATTTC GAAATTGTTAT
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
The original wild-type" DNA strand is: 5'-ATGGGACTAGATACC-3'. Which allele is least likely to show a mutant phenotype? First letter A U UUU UUC UUA UUG CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second letter C Ser Pro Thr Ala 5'-ATGGGATAGATACC-3' ● 5'-ATGGGTCTAGATACC-3' O 5'-ATGCGACTAGATACC-3' O 5'-ATGGGACTAGTTACC-3' CAU CAC CAA CAG UAU Tyr UAC UAA Stop UAG Stop UGG Trp AAU AAC AAA AAG A GAU GAC GAA GAG His Gin Asn Lys Asp G Glu UGU UGC Cys UGA Stop A CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Arg Ser Arg DOAG JOAG DO AO | DOA Third letter Gly C G
Е. F. С. D. A. B. COMPLEMENTARY BASE PAIRING 1. Under each sequence of bases, write the sequence of bases complementary to each section of DNA in the virus X174: ATG T GT CA AAGACGGT Dayonna Rucker C C T G T T T T G T A CCGTCAGGATTGA G T T T T C A T G C CТССАААТСТТ
You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G that is underlined changes to to a C the result will be - A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutation You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G that is underlined is deleted, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutatio If there are 3000 bases in the coding region of a gene, the gene will have A) 3000 amino acids B) 6000 amino acids C) 1000 amino acids D) 3000 codons