Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…
A: Primer is short sequence which is complementary to the base sequence of DNA and is considered to be…
Q: Based on the restriction enzyme specificities given below, which will generate blunt ends?…
A: Restrictions enzyme or restrictions endonucleases is type of protein, produces bacteria that helps…
Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125?…
A: According to the question, we have to answer the question that which is for the chromatograph below,…
Q: A K I D H
A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…
Q: What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA…
A: There are two types of nucleic acids, DNA and RNA. Nucleotides are the building blocks of nucleic…
Q: A new restriction enzyme is discovered. It recognizes a 6 base pair pallindromic sequence. The first…
A: BASIC INFORMATION RESTRICTION ENZYME they are also known as molecular scissors it was in the year…
Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…
A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…
Q: #4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’…
A: A restriction enzyme is a type of enzyme which cleaves DNA into fragments at a specific recognition…
Q: Which of the restriction enzymes listed in the table below produces blunt-end fragments? Enzyme…
A: The blunt end are produced by the restriction enzymes when the end of a DNA fragment after breaking…
Q: The restriction enzyme Smal recognizes the following sequence and cuts it once between the G and C:…
A: Answer. A restriction endonuclease is a bacterial enzyme that cuts double-stranded DNA by cleaving…
Q: The DNA molecule shown below is thought to contain the genetic code for part of an enzyme that…
A: DNA is replicated to form new copies of DNA molecules that further are transcribed into mRNA. An…
Q: Table 2. DNA Sequence 2 from Lactose-Tolerant and -Intolerant Individual Individual Phenotype…
A: Introduction:- Chromosome usually represent the long chain DNA molecules that have the genetic…
Q: Choose the combination of answers that most accurately completes the statement.Which of the…
A: Restriction endonuclease or restriction enzyme is a type of enzyme used in cloning studies. It is…
Q: A researcher wants to cut this piece of linear DNA. 5'…
A: The restriction enzymes are the specific enzymes that act on the DNA molecule and perform its…
Q: Give the correct DNA template for this bacterial gene segment (GGG UCG ACA CỤC UUU). ***"Please use…
A: Since you have posted a question with multiple sub- parts,we will solve the first three sub-parts…
Q: The following DNA sequence is from a bacteriophage that infects a pathogenic bacterium and…
A: Restriction enzymes play a major role in recombinant DNA technology as they can recognise a specific…
Q: Draw a diagram showing what pGEM will look like after it has been digested with BamHI.
A: BamHI: BamHI is a restriction enzyme obtained from Bacillus amyloliquefaciens that specifically cuts…
Q: What are restriction enzymes and what do they do? Complete the chart Driginal DNA sequence 5' TGA…
A: Restriction enzymes bind and cleave double-stranded DNA. There are three categories of restriction…
Q: Coding With the given coding strand perform the following 1. supply the correct non- coding strand…
A: DNA is a double helical molecule.
Q: Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1…
A: Transcription is the process of making RNA copy of gene sequence. This copy is called mRNA.…
Q: You are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA…
A: The restriction endonuclease are responsible for cutting the DNA at specific sequence and they…
Q: Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1…
A: Nucleic acid is a macromolecule that is exhibited inside the nucleus . It consists of DNA and RNA…
Q: 3. You want to insert a sequence in the lacl gene to alter its function, what restriction enzyme(s)…
A: Introduction: The lac operon is a polycistronic structural gene controlled by a promoter and a…
Q: Based on the restriction enzyme specificities given below, which will generate blunt ends?…
A: The given restriction enzymes are endonucleases as they cut nucleotides at specific positions within…
Q: 2. Your Genetics professor gives you and your classmate's information on a restriction digest. The…
A: The advantages of biotechnology for our society can be in drug manufacturing at a low cost using…
Q: AKS 8a2, DOK 1) Based on the gel above, which bands traveled the slowest through the gel during the…
A: Question asked - which bands travelled the slowest? Band 1 because these are bigger pieces of DNA…
Q: The chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction.…
A: Sanger sequencing (also known as chain termination sequencing) is a DNA sequencing technology that…
Q: Another restriction enzyme is called HaellI. It cuts DNA at the following base sequence: CCGG GGCC…
A: restriction enzymes are those enzymes which helps in cutting dna at specific locations .
Q: The map of plasmid pUC19 is shown below. The restriction site coordinate is the position of the…
A: Introduction Plasmid Vectors: these are like the artificial vehicle to deliver our gene of insert…
Q: Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING…
A: The restriction enzymes are type of nuclease enzymes. These enzymes have the capability to cleave…
Q: If the Hinfl restriction enzyme recognizes G^ACTC sites, as seen in the image, belUW. GACTC How many…
A: The cloning of DNA is the mechanism by which a certain fragment of DNA is multiplied. The selected…
Q: The partial sequence of one strand of a double-stranded DNA molecule is5′ – – –…
A: Restriction enzymes also called molecular scissors are originally a part of a bacterial defence…
Q: a) Figure 7 shows a sticky end that is cut by restriction enzyme. AAGCTT ATCGAA Enzyme K 3' Sticky…
A: Restrictions digestion is a process where restrictions enzyme cut a specific sites of DNA. The…
Q: The following is the base sequence of DNA that codes for amino acids 506-510 of the protein that…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…
Q: Which of the following sequences in double-stranded DNA ismost likely to be recognized as a cutting…
A: Enzymes that can cleave the DNA at specific sites are known as restriction enzymes. There are two…
Q: Which of the strands of DNA could act as a PCR primer for the DNA sequence shown below?…
A: Primer It is a short, single-stranded sequence of DNA which is used in the PCR technique. It is used…
Q: Table 1 shows a list of restriction endonucleases with their recognition sequence and the sites of…
A: Restriction enzymes are those that cleave the double stranded DNA at specific site. They have…
Q: #2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC…
A: Restriction enzymes is an enzyme that cleaves DNA into fragments. Recognition sequence is a unique…
Q: sequence? Which enzyme will cut this sequence and where in the sequence? What is the sequence of the…
A: Given: Need to find the recognition sequence and sequence of the 'sticky end' produced by this…
Q: Which of the following single-stranded DNA molecules may possibly be a restriction enzyme target cut…
A: Restriction enzymes are specific endonuclease that are responsible for cutting double standard DNA…
Q: The recognition site of some restriction enzymes are shown. Which will produce sticky ends? A.…
A: Restriction enzymes also known as restriction endonucleases are the enzymes which acts on the…
Q: For the following short sequence of double stranded DNA and the given primers, there will be one…
A: Polymerase chain reaction (PCR) is generally used to produce millions or even billions of copies in…
Q: What will be the MRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA…
A: The template strand is the DNA strand from which mRNA is made. The non-template, or coding, strand…
Q: 8. You have a piece of DNA with the sequence shown below.…
A: EcoRI is one of the most commonly found restriction endonuclease and it is isolated from the E.…
Q: The restriction enzyme Haelll has the recognition sequence below and cuts between the G and bases.…
A: restriction enzymes are the specific endonucleases that have a specific site within the DNA sequence…
Q: What is the role of Mg2+ in this reaction?
A: The given reaction is the DNA synthesis by the DNA polymerase I. DNA polymerase catalyzes the…
Q: 3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’…
A: A restriction enzyme is a type of enzyme which cleaves DNA into fragments at a specific recognition…
Q: .If the template DNA sequence is 3' - CCC - ATA - GAG - AAA - 5' , then what is the corresponding…
A: DNA replication is a process in which new copies of DNA is made.The mode of DNA replication is…
#1 HindII --- 5’ GTC ↓ GAC 3’
5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’
3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’
Restriction enzyme:
Recognition sequence:
Number of pieces of DNA:
Type of cut:
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- #3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .
- Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________position position (5' end) position (3' end) UUU Phe - F UUC Phe UAU Tyr Y. UAC Tyr UAA Stop UGU Cys UGC Cys UGA Stop UGG Trp UCU Ser UCC Ser U UUA Leu UUG Leu UCA Ser UCG Ser UAG Stop W 輔 CAU His CGU Arg CGC Arg CGA Arg CGG Arg CUU Leu CCU Pro CUC Leu CCC Pro P. CCA Pro CÁC His CỦA Leu CAA Gln CUG Leu CCG Pro CAG GIn AUU lle ACU Thr AAU Asn AGU Ser AUC lle ACC Thr -T ACA Thr AAC Asn_ AGC Ser AGA Arg AGG Arg A AUA lle AAA Lys EK AAG Lys AUG Met ACG Thr GUU Val GGU Gly GGC Gly GGA Gly GGG Gly GAU Asp D GAC Asp GCU Ala GUC Val -V GUA Val GCC Ala GCA Ala GCG Ala G - A GAA Glu FE GAG Glu GUG Val Nonpolar Polar Basic Acidic Stop codon Table 4.1 Biology: How Life Works, Third Edition © 2019 W. H. Freeman and Company Consider the DNA sequence–3'-CACTGGTAGCGA–5', • What is the sequence of the messenger RNA sequence that is transcribed from this DNA sequence? (Indicate the 5' and 3' ends of the RNA molecule.) • Consult the genetic code that is shown above. What is the amino acid sequence of the…Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________
- b. Cleavage with chymotrypsin produces the following fragments: Band A: CN , NLQY, GIVEQCCHKRSEY Band B: F, Y, DPTKM, IACCVRGF, RTTGHLCGKDLVNALY Cleavage with Staphilococcus aureus V8 protease produces the following fragments: Band A: GIVE, YNLQNYCN, QCCHKRCSE Band B: PTKM, RTTGHLCGKD, LVNALYIACGVRGFFYD What is the amino acid sequence of the protein? Type your response9 Biology: SC4) x 4 dgv-frqz-vjb x M Inbox (1,514) xB Unit 7: Geneti x O Flipgrid | dc6 x O Worked exam x 4 My Drive - Gc x B copy retake - x G how do you s x + A docs.google.com/document/d/10EqJmVt6VK9YT1NRySx9c2AawGp069S6R6g|28ljkk4/edit I Apps O UCSMP OmnID Portal • SS 9 Home | Schoology M Gmail 4 Google Drive ClassZone - jAvan... flextime.edinasch... N Netflix w Wish - Shopping. >> copy retake ☆ A Share File Edit View Insert Format Tools Add-ons Help Last edit was 2 minutes ago 100% - G E = = E = 1E E - E - E E Image options Replace image- O Editing 31 1 2 | II 3 | 4 5 | 6 7 General Biology Unit 7: Genet. Your "One Pager" must conta. Part 1: Complex Inheritance . + For the two problems, make s.. 2 + Part 2: Pedigree Analysis 2. So, the genotypes of the pare.. II Talking about phenotypes: 2 3 5 6 E I : Shaded individuals have a rare genetic disorder. THIS IS NOT 1. Is the disorder dominant or recessive? How do you know? (Which individuals on the pedigree did you use to make this…You are given the sequence below. Which one would be an appropriate SaCas9 (PAM = ‘NNGRRT’) protospacer? (Multiple possible) 5’-CATGATCTGGGTCATCTTCTCGCGGTTGGCCTTGGGATTGAGGGGGGCCTCGGTGAGCAGGGTGGGG-3’ 5’-AGGCCAACCGCGAGAAGATG-3’ 5’-CATCTTCTCGCGGTTGGCCT-3’ 5’-GAGGGGGGCCTCGGTGAGCA-3’ 5’-CATGATCTGGGTCATCTTCT-3’ 5’-TTGAGGGGGGCCTCGGTGAG-3’
- The sequence shown in Figure 2 is the nucleotide sequence of a heat shock protein of Bacillus anthracis obtained from the NCBI database. >NC_005945.1:2107825-2108262 Bacillus anthracis str. Sterne chromosome ATGCGTAATTTATTTCCAGAAATAACAAAACGTCAAAATGGTATTTTTGATTTTGGACCTTCTTTATTAG AAGGGATGACAGATGCTTTCTTTAAACCGATGAACATGGATATTTTTAAAGTAGATGTTCATGAACAATC TGATAAATATACAGTGAAAGCAGATTTACCAGGTTTTCAAAAAGAAAACATTCAAGTTGAATTTGAACAA GATGTATTAACGATTCAAGCAACTAATCATAATGAAGTAGAAGAAAAAAATGAGAATGGCACATATATTC GTAAAGAACGTTCTATAGGTTCTGTAACTCGACGTTTTAGTTTTAAACAAGTTGAGGAAGAAAATGTTAG AGCGAATTACAAAGATGGCGTGTTGACAATTGAATTGCCAAAATTGAAAGAAGAAAAAAACAGTAAAACA ACAATTAATATTGAATAA Figure 2 (i) Is the nucleotide sequence above translatable into a complete protein? Justify your answer. (ii) Is the sequence above represented in the standard FASTA format? Explain your answer.Which letter represents the target site of furosemide (Lasix)? E- -BAa Po AaBbCcDc AaBbCcDdEe AaBbCcDdE AaBbCcDdE AaBbCcDdE BIUVab x, x A ev A 三==|這、|の Caption Emphasis Heading 1 Heading 3 Heading 4 Style Pane (a) Complete the table, using a letter D, R or B, to show whether each statement applies to: Fo DNA only (D) TA2G – Completed forms must be available for Open Awards external moderation purposes. Page 6 of 15 > T | RNA only (R) Both DNA and RNA (B) Statement D or R or B Contains thymine Contains ribose Consists of two chains connected to each other with hydrogen bonds Has a sugar-phosphate backbone Has four different nitrogenous bases Contains a pentose sugar Is found in the nucleus and cytoplasm English (United Kingdom) Focus 目民 2490 words +1